ID: 922419665

View in Genome Browser
Species Human (GRCh38)
Location 1:225451061-225451083
Sequence CTGAGTGAGCAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922419665_922419668 -8 Left 922419665 1:225451061-225451083 CCCTCTTCCTTCTGCTCACTCAG No data
Right 922419668 1:225451076-225451098 TCACTCAGCTCTAGCCACAGTGG No data
922419665_922419670 7 Left 922419665 1:225451061-225451083 CCCTCTTCCTTCTGCTCACTCAG No data
Right 922419670 1:225451091-225451113 CACAGTGGCCTCCGTGCTGTTGG No data
922419665_922419674 21 Left 922419665 1:225451061-225451083 CCCTCTTCCTTCTGCTCACTCAG No data
Right 922419674 1:225451105-225451127 TGCTGTTGGATTCCACCTCAGGG No data
922419665_922419673 20 Left 922419665 1:225451061-225451083 CCCTCTTCCTTCTGCTCACTCAG No data
Right 922419673 1:225451104-225451126 GTGCTGTTGGATTCCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922419665 Original CRISPR CTGAGTGAGCAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr