ID: 922421703

View in Genome Browser
Species Human (GRCh38)
Location 1:225464943-225464965
Sequence GCGCCCCTCATTTCCTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922421703_922421708 0 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421708 1:225464966-225464988 TGGGGTCTGACCTCACACAAGGG No data
922421703_922421710 8 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421710 1:225464974-225464996 GACCTCACACAAGGGCTGCAGGG No data
922421703_922421707 -1 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421707 1:225464965-225464987 CTGGGGTCTGACCTCACACAAGG No data
922421703_922421712 22 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421712 1:225464988-225465010 GCTGCAGGGTTCAGCTGCAGAGG No data
922421703_922421709 7 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421709 1:225464973-225464995 TGACCTCACACAAGGGCTGCAGG No data
922421703_922421715 30 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG No data
922421703_922421713 23 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421713 1:225464989-225465011 CTGCAGGGTTCAGCTGCAGAGGG No data
922421703_922421714 26 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421714 1:225464992-225465014 CAGGGTTCAGCTGCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922421703 Original CRISPR GCGCCCCTCATTTCCTTCTT TGG (reversed) Intergenic
No off target data available for this crispr