ID: 922421711

View in Genome Browser
Species Human (GRCh38)
Location 1:225464976-225464998
Sequence AACCCTGCAGCCCTTGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922421711_922421717 7 Left 922421711 1:225464976-225464998 CCTCACACAAGGGCTGCAGGGTT No data
Right 922421717 1:225465006-225465028 AGAGGGAGGCTGGGCTTCTGAGG No data
922421711_922421714 -7 Left 922421711 1:225464976-225464998 CCTCACACAAGGGCTGCAGGGTT No data
Right 922421714 1:225464992-225465014 CAGGGTTCAGCTGCAGAGGGAGG No data
922421711_922421713 -10 Left 922421711 1:225464976-225464998 CCTCACACAAGGGCTGCAGGGTT No data
Right 922421713 1:225464989-225465011 CTGCAGGGTTCAGCTGCAGAGGG No data
922421711_922421716 -2 Left 922421711 1:225464976-225464998 CCTCACACAAGGGCTGCAGGGTT No data
Right 922421716 1:225464997-225465019 TTCAGCTGCAGAGGGAGGCTGGG No data
922421711_922421715 -3 Left 922421711 1:225464976-225464998 CCTCACACAAGGGCTGCAGGGTT No data
Right 922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG No data
922421711_922421719 30 Left 922421711 1:225464976-225464998 CCTCACACAAGGGCTGCAGGGTT No data
Right 922421719 1:225465029-225465051 CCACTTGCACTGCAGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922421711 Original CRISPR AACCCTGCAGCCCTTGTGTG AGG (reversed) Intergenic
No off target data available for this crispr