ID: 922421715

View in Genome Browser
Species Human (GRCh38)
Location 1:225464996-225465018
Sequence GTTCAGCTGCAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922421711_922421715 -3 Left 922421711 1:225464976-225464998 CCTCACACAAGGGCTGCAGGGTT No data
Right 922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG No data
922421703_922421715 30 Left 922421703 1:225464943-225464965 CCAAAGAAGGAAATGAGGGGCGC No data
Right 922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922421715 Original CRISPR GTTCAGCTGCAGAGGGAGGC TGG Intergenic
No off target data available for this crispr