ID: 922429080

View in Genome Browser
Species Human (GRCh38)
Location 1:225529220-225529242
Sequence CAGATCATGCAGGACCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922429080_922429084 18 Left 922429080 1:225529220-225529242 CCTGCAAGGTCCTGCATGATCTG No data
Right 922429084 1:225529261-225529283 CTCTTGTGCTCCAGCCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922429080 Original CRISPR CAGATCATGCAGGACCTTGC AGG (reversed) Intronic
No off target data available for this crispr