ID: 922430176

View in Genome Browser
Species Human (GRCh38)
Location 1:225543979-225544001
Sequence TCGTGCATTTGGAAGCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922430176_922430181 22 Left 922430176 1:225543979-225544001 CCATCACGCTTCCAAATGCACGA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 922430181 1:225544024-225544046 TAAAAATCGTGGAACAGGTTTGG 0: 1
1: 0
2: 0
3: 8
4: 148
922430176_922430180 17 Left 922430176 1:225543979-225544001 CCATCACGCTTCCAAATGCACGA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 922430180 1:225544019-225544041 AGCTGTAAAAATCGTGGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 92
922430176_922430179 11 Left 922430176 1:225543979-225544001 CCATCACGCTTCCAAATGCACGA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 922430179 1:225544013-225544035 AGATTAAGCTGTAAAAATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922430176 Original CRISPR TCGTGCATTTGGAAGCGTGA TGG (reversed) Intronic
903208680 1:21802568-21802590 TCATGGATTTGGAAGTGAGATGG + Intergenic
904782363 1:32960282-32960304 ATGTGCATTTGGTAGGGTGAGGG - Intronic
910324155 1:85985352-85985374 TGATGCTTTTGGAAGAGTGATGG + Intronic
916023960 1:160818292-160818314 TGGTGCATTTGGAAGCGAAAAGG + Exonic
916851803 1:168711725-168711747 TCCTGCATCTGGGAGGGTGAAGG + Intronic
922430176 1:225543979-225544001 TCGTGCATTTGGAAGCGTGATGG - Intronic
923213908 1:231831787-231831809 TCGTCCTTTTGCAAGAGTGAGGG + Intronic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1068854065 10:61779449-61779471 TTTTGCATTTGGGAGAGTGATGG - Intergenic
1073704546 10:105968320-105968342 TGGTGTATATGGAAGCCTGAAGG + Intergenic
1077714307 11:4566381-4566403 TCCTGCCTTTGGAAGCCTAAAGG + Intergenic
1084252330 11:67909812-67909834 TCCTGCATTTGGAAGCTTTCAGG - Intergenic
1090112339 11:123927176-123927198 TGCTGCATTTGGAAGCATAATGG + Intergenic
1100079456 12:90830234-90830256 TTGTGAATTTGGCAGCTTGAAGG + Intergenic
1100940626 12:99719616-99719638 TAGTGCTTTTGCAAGAGTGAGGG - Intronic
1106463065 13:29989721-29989743 TCCTCCAGTTGGAAGTGTGACGG + Intergenic
1106751879 13:32780991-32781013 TGATGGATATGGAAGCGTGAGGG + Intergenic
1110236990 13:73227433-73227455 GTGTGCATTGGGAAGGGTGAAGG - Intergenic
1114699998 14:24667160-24667182 TCATGCATCTGGAAGTGAGAGGG + Intergenic
1120052316 14:79881529-79881551 TAGTGCATTTGGAAGTTTTATGG - Intergenic
1131078226 15:89512601-89512623 TTGTGGATTTGGAAGTGTCAGGG + Intergenic
1158535165 18:58301925-58301947 GTGTGCACTTGGAAGTGTGATGG + Intronic
1161373132 19:3924832-3924854 TCGTGAGTGTGGAAGGGTGAGGG - Exonic
1164438370 19:28251964-28251986 TCCTGAAATTGGAAGCATGATGG + Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
929383886 2:41382438-41382460 TAGTCCATTTGCAAGAGTGAGGG - Intergenic
948758637 2:240175323-240175345 TGATTCATTTGGAAGCGTAAAGG - Intergenic
1170346332 20:15390905-15390927 TCATGGATTAGGAAGTGTGATGG - Intronic
1180149157 21:45938927-45938949 ACGTCCACTTGCAAGCGTGAAGG - Intronic
1182180336 22:28340363-28340385 TAGTGAATTTGGAGGCATGAAGG - Intronic
1183607643 22:38875304-38875326 TCAGGCAGTGGGAAGCGTGAGGG + Intergenic
957066388 3:75526223-75526245 TCCTGCATTTGGAAGCTTTCAGG - Intergenic
957875365 3:86139311-86139333 TTGTGCATTTGAAAGCTTGTTGG - Intergenic
957904520 3:86539589-86539611 TAGTTCATTTGCAAGAGTGAGGG + Intergenic
961587045 3:127939303-127939325 TTCTGCATTTGGAAGCTTGTTGG - Intronic
969010990 4:4062279-4062301 TCCTGCATTTGGAAGCATTCAGG - Intergenic
969743075 4:9047615-9047637 TCCTGCATTTGGAAGCATTCAGG + Intergenic
970598553 4:17622154-17622176 TAGGGCATTTGGAAGTGTGTTGG + Intronic
977422928 4:96826707-96826729 TGGTGCATTTGGAAGCTTTGAGG - Intergenic
982236214 4:153253419-153253441 GTGTGCATTTGGAAATGTGAAGG - Intronic
985098638 4:186435623-186435645 TGGTGCATTAGGAAGTATGATGG - Intronic
994606833 5:101978425-101978447 TGGTGCATTTGCAAGGGAGATGG + Intergenic
998370170 5:141655754-141655776 TCGTGCTGGTGGGAGCGTGAGGG + Exonic
1000965601 5:167652484-167652506 TCTTGCATTTGCAACAGTGAGGG + Intronic
1007724469 6:43906734-43906756 TGGTGCATTTGGCAGTGTGTGGG + Intergenic
1007919127 6:45590217-45590239 TCTTGCAGTTGGAAGAGAGATGG - Intronic
1009464662 6:63954380-63954402 TCGTCCCTTTGCAAGAGTGAGGG - Intronic
1017620937 6:156296422-156296444 TCTTCCTTTTGGAAGCATGAAGG - Intergenic
1023643743 7:42287867-42287889 TGGTGCATTTGAAGGAGTGAGGG - Intergenic
1029070278 7:97890303-97890325 TCCTGCATTTGGAAGCATTCAGG - Intergenic
1029153994 7:98502041-98502063 CAGTGCATTTGGAAGGGGGATGG + Intergenic
1029658921 7:101946031-101946053 TTGTGGATTTGGAAGGGTGGAGG + Intronic
1031354918 7:120778725-120778747 TAGTGCTTTTGCAAGAGTGAGGG + Intergenic
1036885962 8:12553570-12553592 TCCTGCATTTGGAAGCATTCAGG - Intergenic
1036893579 8:12612656-12612678 TCCTGCATTTGGAAGCTTTCAGG - Intergenic
1037849437 8:22314615-22314637 CTGTTCATTTGGAAGCATGAGGG - Intronic
1045918893 8:107506849-107506871 TCTTGCGTTTGGAAGAGTGTTGG + Intergenic
1046075146 8:109304535-109304557 TAGTGCCTTTGCAAGAGTGAGGG - Intronic
1046795243 8:118364585-118364607 CTGTGCATGTGAAAGCGTGAGGG - Intronic
1057828674 9:98390702-98390724 TCTTGCATTTGGTAGCCAGAAGG - Intronic
1058692161 9:107528885-107528907 TCCGGCATTTGGATGCCTGAGGG - Intergenic
1061261091 9:129481582-129481604 TCGTGCATATGGCAGCCAGAGGG - Intergenic
1194025259 X:88743634-88743656 TCTTGCATGTGGAAGCGGAAAGG - Intergenic
1198698108 X:139365388-139365410 TCTTGCATTTGTAAGGTTGAGGG + Intergenic