ID: 922440832

View in Genome Browser
Species Human (GRCh38)
Location 1:225653551-225653573
Sequence GCGCCTCGGTCTCCGCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922440832_922440847 26 Left 922440832 1:225653551-225653573 CCACGGTGCGGAGACCGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 922440847 1:225653600-225653622 AGGCACCGGCGTGGGGAGCTTGG 0: 1
1: 0
2: 0
3: 22
4: 198
922440832_922440838 6 Left 922440832 1:225653551-225653573 CCACGGTGCGGAGACCGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 922440838 1:225653580-225653602 CTCCTGGGCGCCAGACCCGTAGG 0: 1
1: 0
2: 1
3: 6
4: 108
922440832_922440844 19 Left 922440832 1:225653551-225653573 CCACGGTGCGGAGACCGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 922440844 1:225653593-225653615 GACCCGTAGGCACCGGCGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 37
922440832_922440835 -9 Left 922440832 1:225653551-225653573 CCACGGTGCGGAGACCGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 922440835 1:225653565-225653587 CCGAGGCGCCGAGACCTCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 83
922440832_922440843 18 Left 922440832 1:225653551-225653573 CCACGGTGCGGAGACCGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 922440843 1:225653592-225653614 AGACCCGTAGGCACCGGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 21
922440832_922440842 17 Left 922440832 1:225653551-225653573 CCACGGTGCGGAGACCGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 922440842 1:225653591-225653613 CAGACCCGTAGGCACCGGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 48
922440832_922440833 -10 Left 922440832 1:225653551-225653573 CCACGGTGCGGAGACCGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 922440833 1:225653564-225653586 ACCGAGGCGCCGAGACCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 60
922440832_922440840 12 Left 922440832 1:225653551-225653573 CCACGGTGCGGAGACCGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 922440840 1:225653586-225653608 GGCGCCAGACCCGTAGGCACCGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922440832 Original CRISPR GCGCCTCGGTCTCCGCACCG TGG (reversed) Intergenic
900191856 1:1355432-1355454 GGTCCCCGGTCCCCGCACCGCGG + Exonic
905009553 1:34738011-34738033 GTGCCTCAGTCTCCCCACCTGGG + Intronic
916683722 1:167126405-167126427 GCGCCGCCGCCTCCCCACCGAGG - Exonic
918423529 1:184386906-184386928 GCGCCTGGCTCTCCTCCCCGGGG - Intergenic
922440832 1:225653551-225653573 GCGCCTCGGTCTCCGCACCGTGG - Intergenic
1070257571 10:74825365-74825387 CCGCCCCAGTCTCCGCCCCGGGG - Intergenic
1072706923 10:97687444-97687466 GCGCCTCGGGCGCCGCGCGGGGG - Intergenic
1073178572 10:101570626-101570648 GCCCCTCGGGCTCCGCAGGGAGG - Intronic
1074955325 10:118383243-118383265 GCCCCTGGGGCTCCTCACCGAGG + Intergenic
1075007438 10:118840974-118840996 GCACTTCGGTCTCCCCACCAAGG - Intergenic
1084129202 11:67119801-67119823 GCGCCCCGGGCTCGGCGCCGAGG + Exonic
1111390242 13:87584778-87584800 GGGCCTCGGTTTCCACATCGAGG - Intergenic
1114888182 14:26881136-26881158 GCACCTCAGTCTCAGCACCTGGG + Intergenic
1120878636 14:89397465-89397487 GAGCCTCGGTCTCCACAGCAGGG - Intronic
1122762077 14:104036407-104036429 GCACATCTGTCTCCCCACCGAGG - Intronic
1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG + Intergenic
1127426749 15:58865410-58865432 GCGCCATGGCCTCCCCACCGTGG - Intronic
1127988757 15:64095878-64095900 GCCCCTAGGTCTCCGCCCCTCGG + Intronic
1128348903 15:66876189-66876211 CAGCCTCGGTCTCCCCACCTCGG - Intergenic
1128999338 15:72319805-72319827 GCGCCTGGGTTTCAGCACCGCGG - Exonic
1130261295 15:82355770-82355792 GCGGCGCGGACTCCACACCGCGG - Intergenic
1130279940 15:82513248-82513270 GCGGCGCGGACTCCACACCGCGG + Intergenic
1130471315 15:84229434-84229456 GCGGCGCGGACTCCACACCGCGG + Intergenic
1130478809 15:84344005-84344027 GCGGCGCGGACTCCACACCGCGG + Intergenic
1130492961 15:84444126-84444148 GCGGCGCGGACTCCACACCGCGG - Intergenic
1130593609 15:85234061-85234083 GCGGCGCGGACTCCACACCGCGG + Intergenic
1133311112 16:4847443-4847465 GCGCCGCGGTCTCCGCGCGCCGG + Intronic
1133623196 16:7545844-7545866 GAGCCTCTGTCTCTGCATCGGGG + Intronic
1143309562 17:5977307-5977329 ATGCCTCGGTCTCCCCACAGGGG - Intronic
1143411859 17:6713874-6713896 GCCCCGCGCCCTCCGCACCGCGG + Intergenic
1147436372 17:40418687-40418709 GCGCCTCGATCTCCGATCCCCGG - Intergenic
1148452685 17:47790198-47790220 GGTCCTCGGGCTCCGCTCCGCGG + Intergenic
1151740481 17:75978890-75978912 GCGCCCCTGACTCCGCATCGAGG + Intronic
1151801983 17:76384279-76384301 GCGCCTCCGTCTGCGCTGCGCGG + Intronic
1151983737 17:77528968-77528990 GCACATCGTGCTCCGCACCGAGG - Intergenic
1152353787 17:79797323-79797345 TCGCCTCGGACTCCGCCCCCTGG - Intronic
1152932150 17:83115474-83115496 GCCCCTCACTCTCCCCACCGAGG - Intergenic
1157849062 18:51030509-51030531 GCTCCTCGGCCCCCGCCCCGAGG - Exonic
1160798278 19:955557-955579 GCGCCTCGGTTTCCCCATCCGGG + Intronic
1160895750 19:1401174-1401196 GCGCCTCTGTCTCCTCGCCTGGG - Intronic
1162589102 19:11578997-11579019 GCGCCTCGGCCTCCCCGCCCCGG + Intronic
1162742048 19:12778951-12778973 GTGCCTGGATCTCCGCACAGCGG - Intronic
1166304513 19:41929837-41929859 GCACCTCGGTCTCAGCACCTGGG - Intronic
925286827 2:2721510-2721532 GCACCTGGGTCTCCACACCCTGG + Intergenic
930798559 2:55419499-55419521 GCGCCTCGGTATCCTTAACGTGG - Exonic
934709923 2:96508198-96508220 CCGCCTCAGTCTCTGCACAGCGG - Intergenic
936069124 2:109353616-109353638 GTGCCTCTGTCTCCTCACCCAGG + Intronic
937871492 2:126789325-126789347 GGGCCTCAGTCCCCGCACCCAGG - Intergenic
940354007 2:152718663-152718685 GCGCCGCGGTCCCGGCACCCCGG + Exonic
941987366 2:171522521-171522543 GCGCCCCATACTCCGCACCGCGG - Exonic
1171567683 20:26209387-26209409 GCGCCTCGGTGTCCGCGCGTGGG - Intergenic
1173945144 20:46944378-46944400 CAGCCTCGGTCTCCTCACCTGGG + Intronic
1176124280 20:63468561-63468583 GCGCCTGGGCCCCGGCACCGGGG + Intronic
1179551767 21:42147819-42147841 TCCCCTCGGTGTCCACACCGTGG - Intergenic
1179893712 21:44350311-44350333 CCGCCTCAGTCCCCGCACCCGGG - Intronic
1180013731 21:45069391-45069413 GAGCCTCCGTCCCCTCACCGGGG + Intergenic
1180176345 21:46092062-46092084 GAGCCTCGGTCTCCTCTCTGTGG + Intergenic
1181006811 22:20017396-20017418 GCCCCTGGGTCCCCGCAGCGGGG + Intronic
951563334 3:23989241-23989263 GGGCCTAGGTCTGCGCACCATGG + Intergenic
952741462 3:36738482-36738504 GGGTCTCGGTCTCCCCACAGCGG + Exonic
969676972 4:8619636-8619658 GGGCCTCGGTCTCCACATCCTGG - Exonic
976169067 4:82284977-82284999 CCGCCCCGGTCACCGCCCCGAGG + Intergenic
980075147 4:128287232-128287254 GCGCCTCGGCCGCCGCACCTGGG - Intronic
985988405 5:3536143-3536165 GCACCTGGGTCCCCGCACCTGGG - Intergenic
994710583 5:103259374-103259396 GCGCCCCGACTTCCGCACCGCGG - Intronic
998130380 5:139648692-139648714 GCGACTCGGGCTCCGGACCCGGG + Exonic
1019190671 6:170249022-170249044 GGGGCTGGGTCTCCACACCGAGG - Intergenic
1019665504 7:2250152-2250174 GAGCCGTGGTCTCTGCACCGAGG + Intronic
1026869184 7:73840441-73840463 GCGCCTCAGCCTCTGCACCCTGG - Exonic
1026968220 7:74453682-74453704 GCGGCGCGCTCTCCCCACCGCGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1034264132 7:149773129-149773151 GCGCCTGGGTCCCCGCGGCGCGG - Exonic
1034433241 7:151051244-151051266 GCGGCTCGGGATCCGCACCATGG - Exonic
1049256570 8:141617270-141617292 GCGCCTTTGTCTCCACACCCTGG + Intergenic
1051079620 9:13279361-13279383 GCGCCTCGGCCTCTGGGCCGGGG + Intronic
1053427813 9:38022573-38022595 GTGCCTCTGTCCCCGCTCCGAGG + Intronic
1060481274 9:124017966-124017988 GCGCCTGGGTTTGCGCGCCGCGG + Intronic
1061863487 9:133479430-133479452 GGGCCTCGGTTTCCACCCCGCGG - Intergenic
1196793257 X:119482862-119482884 TCGCCTCGGCCTGGGCACCGCGG + Intergenic
1200279226 X:154762786-154762808 GCGCCTCGGATTCCGCCCCCGGG + Exonic