ID: 922440911

View in Genome Browser
Species Human (GRCh38)
Location 1:225653861-225653883
Sequence TGGGATTCCTCGGGAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922440911_922440919 23 Left 922440911 1:225653861-225653883 CCTTTTCTTCCCGAGGAATCCCA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 922440919 1:225653907-225653929 TTGATGTGCACACTAGGTATAGG 0: 1
1: 0
2: 0
3: 2
4: 59
922440911_922440918 17 Left 922440911 1:225653861-225653883 CCTTTTCTTCCCGAGGAATCCCA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 922440918 1:225653901-225653923 AACGAGTTGATGTGCACACTAGG 0: 1
1: 0
2: 0
3: 2
4: 71
922440911_922440920 24 Left 922440911 1:225653861-225653883 CCTTTTCTTCCCGAGGAATCCCA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 922440920 1:225653908-225653930 TGATGTGCACACTAGGTATAGGG 0: 1
1: 0
2: 0
3: 8
4: 78
922440911_922440914 -6 Left 922440911 1:225653861-225653883 CCTTTTCTTCCCGAGGAATCCCA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 922440914 1:225653878-225653900 ATCCCAGCGTGCTGCGCCGATGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922440911 Original CRISPR TGGGATTCCTCGGGAAGAAA AGG (reversed) Intergenic
900290136 1:1920257-1920279 TGGGGTCCCCCTGGAAGAAATGG - Intergenic
900538262 1:3189746-3189768 TGGGATTCCCCTGGAGGAGAGGG + Intronic
901224767 1:7606838-7606860 TGGGATGGCTGGGGAGGAAATGG + Intronic
903341020 1:22654323-22654345 TGGGCTTCCTGGGGAAGCCAGGG - Intronic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
906531862 1:46528322-46528344 TGGGATGGCACGGGAAGGAAGGG - Intergenic
909794064 1:79711376-79711398 TGGAATTCCTGGGTAGGAAATGG + Intergenic
910081357 1:83346114-83346136 TGGGTTTCCTCAGGAGGAAAGGG - Intergenic
910981616 1:92963973-92963995 TGGGAATGATCCGGAAGAAAAGG + Intergenic
915243283 1:154539218-154539240 TGGGATTCCTGGTGTAGAAGAGG + Intronic
919842238 1:201618132-201618154 TGGGGTGGCTGGGGAAGAAAGGG - Intergenic
920045091 1:203127814-203127836 AGGGATTCCTGGGGAAGCCAAGG - Exonic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
922919495 1:229290122-229290144 TGGGACTCCAGAGGAAGAAATGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063967153 10:11355034-11355056 TGGGATGCTTGGGGCAGAAAAGG + Intergenic
1067494785 10:46752007-46752029 TGAGATTCCCCGGGGAGAACTGG - Intergenic
1067599870 10:47588390-47588412 TGAGATTCCCCGGGGAGAACTGG + Intergenic
1070704785 10:78629755-78629777 TGTGATTTCTTGGGAAGAAGTGG - Intergenic
1071651405 10:87396273-87396295 TGAGATTCCCCGGGGAGAACTGG + Intergenic
1073961676 10:108937998-108938020 TGGAATTCCTCCTGAAGAACAGG - Intergenic
1075018326 10:118927578-118927600 TGGGATTCCTCAAAAAGAATTGG + Intergenic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1079355209 11:19724864-19724886 TGAGATTCCTCGTAAATAAATGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081372900 11:42325763-42325785 TGGGATTCCTAGAGATGAATAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083396949 11:62398858-62398880 TGGAATTTCTAGGGAAGACAGGG - Intergenic
1083429822 11:62608492-62608514 TGGGGTTCCTAGGCAAGAATGGG + Intronic
1088451488 11:109985944-109985966 TGGGTTTTCTCTGGAAGAAGGGG + Intergenic
1088834780 11:113568425-113568447 TGGGCTTCCCGGGGAGGAAAAGG - Intergenic
1091774123 12:3173201-3173223 GGGCTTTCCTCGGGAAGACAGGG - Intronic
1092117101 12:6017154-6017176 TAGGCTTCCTCGGTAAGAAGGGG + Intronic
1092796306 12:12113425-12113447 GGGGATTCCATGGGAAGGAAAGG - Intronic
1092964976 12:13632730-13632752 TGGGATTCCACGGGGAGGGAGGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096705097 12:53415866-53415888 TGGGATTTCACTGGGAGAAAGGG - Intronic
1097949675 12:65413810-65413832 TGGGAATGCTAGGGAAGACAGGG + Intronic
1098818046 12:75193372-75193394 CGGATTTCCTTGGGAAGAAAAGG - Intronic
1099980188 12:89591011-89591033 TGGGCTTCCTGGGGATGAAGAGG + Exonic
1100149319 12:91716159-91716181 TGGCATTCATGGGAAAGAAATGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1102497705 12:113330811-113330833 TGGGATTCCTGCTGAAGAAATGG + Intronic
1103417465 12:120752643-120752665 TGGTATCACTCCGGAAGAAAAGG + Intergenic
1106155737 13:27154117-27154139 TGTGCTTCCTAAGGAAGAAAGGG - Intronic
1109585691 13:64399901-64399923 GGGGAGTACTTGGGAAGAAATGG - Intergenic
1110829470 13:80013499-80013521 AGGGATCCCACGGTAAGAAAAGG - Intergenic
1112638907 13:101249312-101249334 TGGGATCCCTGGTGGAGAAAGGG - Intronic
1113634947 13:111913071-111913093 TTGGAATCCTCGTGAAGAACGGG + Intergenic
1114390630 14:22304191-22304213 TGGGTTCCCTCGGGAGGAACAGG + Intergenic
1114568799 14:23651346-23651368 TGGGATGCCTCTGGAAGAGTGGG + Intergenic
1117153479 14:52913313-52913335 TGAGATCCCTCGGGAGTAAATGG + Intronic
1117302783 14:54444984-54445006 TGGGATTCATCTGGAAAAAGGGG - Intergenic
1119825179 14:77651716-77651738 TAGGAGTCCTCTGGAAGGAAAGG + Intergenic
1121509654 14:94502879-94502901 TGGGGTTCCTGGGGCAGGAAGGG - Intronic
1125140515 15:36401012-36401034 CGGGACTCTTCTGGAAGAAAAGG - Intergenic
1125747312 15:42005636-42005658 TGGGACTCTGAGGGAAGAAAAGG + Intronic
1130719909 15:86376494-86376516 CAGGATTCCACAGGAAGAAAAGG - Intronic
1131057981 15:89387416-89387438 GGGGCTTCCTAGGGAAGGAAAGG - Intergenic
1132031654 15:98443564-98443586 TGAGATTCCCAGGGAAGAGAAGG + Intronic
1132332665 15:101023566-101023588 TGTGATTCCTCGGGATCCAAGGG + Intronic
1132520250 16:383964-383986 TGGGATTCCCGGGAAACAAAGGG - Intronic
1133604131 16:7369278-7369300 TGAGCTTCCTCTGGAAGACATGG - Intronic
1137852940 16:51764326-51764348 TGGGACTCCTCAGCCAGAAAAGG - Intergenic
1138121072 16:54401516-54401538 CGGGCATCCTTGGGAAGAAAAGG + Intergenic
1140089542 16:71826305-71826327 TGGACTCCCTGGGGAAGAAATGG + Intergenic
1141228852 16:82145623-82145645 TGCGACTCCTAGGGAAGAGAGGG + Intergenic
1141566607 16:84906591-84906613 GGGGACTCCTCGGGATGGAAAGG + Exonic
1141644917 16:85362119-85362141 TGGGATTCCTCTGGCAGGCAAGG + Intergenic
1141955202 16:87366147-87366169 TGGGATTCTGGGAGAAGAAAAGG + Intronic
1143743501 17:8972494-8972516 TGGCATTCCACTGTAAGAAAGGG - Intergenic
1144481326 17:15631800-15631822 TGGGCTTCCTGGGGAAAGAAGGG + Intronic
1144916979 17:18731931-18731953 TGGGCTTCCTGGGGAAAGAAGGG - Intronic
1145025781 17:19466898-19466920 TGGGTTTTCTCTGGAAGGAATGG + Intergenic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1149969258 17:61200024-61200046 TTGGATTATTCTGGAAGAAAGGG - Intronic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1151218525 17:72593778-72593800 TGGGATTGCTGGAGAGGAAATGG + Intergenic
1152249615 17:79204912-79204934 TGGTGTTCCTGGGGATGAAATGG + Intronic
1152606922 17:81295972-81295994 GAGAATTCCTCGGGTAGAAATGG + Intergenic
1153828904 18:8902215-8902237 TGGTAATCCTGAGGAAGAAAAGG + Intergenic
1158217030 18:55111097-55111119 TGAGATGCTTGGGGAAGAAAAGG - Intergenic
1158664776 18:59422567-59422589 TGGGGTCCCTCGGGGATAAAAGG - Intergenic
1161748545 19:6077005-6077027 CTGGATTTCTAGGGAAGAAAAGG - Intronic
1162659511 19:12157944-12157966 TGGGATGCCTCCTGGAGAAAGGG + Intergenic
1163607358 19:18282254-18282276 TGTGATTGCTCAGGAAGAGACGG + Intergenic
1164793956 19:31011520-31011542 TGGGTTTCATGGGGATGAAATGG - Intergenic
1165087403 19:33360751-33360773 TGGGATCCCTCAGGAGGGAAGGG + Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
924983792 2:248911-248933 GGGGATACCTTGGTAAGAAATGG + Intronic
925121766 2:1423917-1423939 AGGAATTCCTGGGGAAGACATGG + Intronic
926791133 2:16573075-16573097 TTGCATTCCTCGGGCAGAAACGG - Intronic
927574417 2:24189660-24189682 TAGGCTTCCTGGGGCAGAAATGG + Intronic
930862261 2:56087270-56087292 AGGGGTTCCTGGTGAAGAAAAGG + Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
937896698 2:126981541-126981563 TGGTAGTCCCCGGGAAGAAAGGG + Intergenic
940139522 2:150478297-150478319 TGGGCTTTATGGGGAAGAAAAGG - Intronic
941147914 2:161875879-161875901 AGGGATTCTCTGGGAAGAAATGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941665207 2:168237863-168237885 GGGGTTTCCTGGGGAAGGAATGG - Intronic
942090661 2:172487336-172487358 TGGGATTCCTTGGGTTGGAAGGG - Exonic
942447787 2:176089696-176089718 AAGGATGCCTCTGGAAGAAAAGG + Intergenic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945633735 2:212319965-212319987 TGGGATTTTTGGGGAAGGAATGG - Intronic
946970335 2:225083738-225083760 GGGGCTTTCTGGGGAAGAAATGG + Intergenic
1168994454 20:2122508-2122530 TGGGATTCCCCTGAAAGAAGTGG + Intronic
1169343330 20:4812194-4812216 TGGGCTGCCTCGGAAGGAAATGG + Intronic
1169655526 20:7918549-7918571 GGGGATTCCTTGGGGAGAAAAGG - Intronic
1171295690 20:24014808-24014830 TGGGATTCTTCCAGAAGCAAAGG + Intergenic
1174850035 20:53985069-53985091 TGTGTTTCGTGGGGAAGAAAAGG - Intronic
1176827580 21:13714938-13714960 TGCGCTGCCTGGGGAAGAAAGGG + Intergenic
1177176600 21:17706124-17706146 TGGCATTCCTGAGGAAGAAGAGG + Intergenic
1180568539 22:16695643-16695665 TGGGCTTCCTCGGTAAGAAGGGG + Intergenic
1183163549 22:36130954-36130976 TGGGATTTCCTGTGAAGAAAAGG - Intergenic
950690106 3:14648985-14649007 TGGGTTTGTTCTGGAAGAAAGGG - Intergenic
953270583 3:41439084-41439106 TGGGGTTCCCCGTGAACAAAAGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
960526094 3:118712154-118712176 TGGAATTCCTCTGTAAGGAAGGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962454387 3:135551850-135551872 TGGGACTGCTAGAGAAGAAATGG - Intergenic
962716190 3:138128153-138128175 TGTGATTCATCTGTAAGAAAAGG + Intronic
962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG + Intergenic
963106096 3:141648610-141648632 TGGCAGTCTTCGGGAGGAAAGGG - Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
974633423 4:64526599-64526621 TGGGACACCTCTGGTAGAAATGG + Intergenic
976600742 4:86935394-86935416 TGGGAGCCCTCGGGGAGAACGGG + Intronic
976888766 4:90018391-90018413 TGCAAGTTCTCGGGAAGAAACGG + Intergenic
980063528 4:128156451-128156473 CAGGATTCCTCCGGCAGAAATGG - Intronic
981085179 4:140676159-140676181 TGTGATTTCAAGGGAAGAAATGG - Intronic
983493713 4:168418844-168418866 TGGGAAGCCTAGGCAAGAAATGG + Intronic
984592822 4:181635747-181635769 TAGGATTTCCTGGGAAGAAAGGG + Intergenic
984673034 4:182513970-182513992 GTGGTTTCCTTGGGAAGAAATGG - Intronic
992245543 5:74818668-74818690 AGTGTTTCCTCGGGAACAAATGG + Intronic
992562481 5:77966221-77966243 TGGGATTTCTCAAGTAGAAAAGG + Intergenic
992609250 5:78493144-78493166 TGGGATTCCTTTGGTAGAAGAGG - Intronic
993809315 5:92456217-92456239 TGGAGTTCCTGGGGCAGAAATGG - Intergenic
999082200 5:148855224-148855246 AGGGTTTCCAGGGGAAGAAAAGG + Intergenic
1002491255 5:179579138-179579160 TGAGAGTCCTCAGGAAGACATGG - Intronic
1003344114 6:5249847-5249869 TGGGATTCAGTGTGAAGAAAGGG + Intronic
1007615595 6:43178220-43178242 TGGAATTCCTAGGGACGGAATGG + Intronic
1013400525 6:109791481-109791503 TGGGACTGATCGGGAAGAAGAGG + Exonic
1015188661 6:130448453-130448475 TGGGCTTCCAATGGAAGAAAAGG + Intergenic
1015362222 6:132353774-132353796 AGGTATTCCTGAGGAAGAAAAGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1019183550 6:170207984-170208006 TAGGATTCTTCTGGAAGAAGTGG - Intergenic
1019842321 7:3459832-3459854 TGGGATTCCTTGAATAGAAAAGG + Intronic
1020426403 7:8071059-8071081 TGGGATTCCGGGGGACAAAAAGG - Exonic
1024007908 7:45241089-45241111 TGGGATGCCCAGGGAAGAGAGGG + Intergenic
1027298841 7:76808356-76808378 TGGGTTTCCTCAGGAGGAAAGGG - Intergenic
1027532725 7:79354991-79355013 TGGTATTCCTCAGGTAGAGAAGG - Intronic
1029494923 7:100891331-100891353 TGGGATCCCTGCGGAAGGAAGGG + Exonic
1029618448 7:101674897-101674919 TGGTTTTCTTCTGGAAGAAAGGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030895384 7:115053152-115053174 TGGGTTTCCTTGGGCTGAAAAGG - Intergenic
1030934911 7:115573791-115573813 TGGGCTTCCCCAGGTAGAAAAGG - Intergenic
1032168855 7:129567379-129567401 TGGGAGGGCTCTGGAAGAAAAGG + Intergenic
1033708021 7:143907183-143907205 TGGGAATGCTCCAGAAGAAAAGG + Intergenic
1034266479 7:149783496-149783518 TGGCATTCCTTGGGAGGAGATGG - Intergenic
1035642880 8:1197379-1197401 TTGGGTTCCCCGGAAAGAAAAGG - Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1045154600 8:99453343-99453365 TAGGATTCCTTGGGGAGAAAAGG + Intronic
1049020972 8:139957509-139957531 TGGGTGTCCTCGGGAATAAAAGG + Intronic
1049782228 8:144434317-144434339 TGGGATTCAGAGGGCAGAAAGGG - Intronic
1050245117 9:3681232-3681254 TGGGAGCACTAGGGAAGAAAAGG + Intergenic
1050951563 9:11602007-11602029 TGGGAGTTTTCAGGAAGAAAAGG - Intergenic
1051581213 9:18676936-18676958 TGTGATTGTTCGGGAAGAAATGG - Intronic
1052982922 9:34461913-34461935 TGGGATCCCTGGGGATGAAGGGG + Intronic
1053266929 9:36721921-36721943 TGGGTTTCCTTAGGAAGAATAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059979912 9:119760333-119760355 TAGGATTCCCAGGGAAGAAGTGG + Intergenic
1060136377 9:121159252-121159274 GGGAATTCCTGGAGAAGAAATGG - Intronic
1062361729 9:136191513-136191535 TGGGATGCCCTGGGCAGAAAAGG - Intergenic
1062587068 9:137254211-137254233 TGGGATTCCTCTCTGAGAAAGGG - Intergenic
1186438388 X:9563786-9563808 TGGGAATTCCAGGGAAGAAAGGG + Intronic
1186631758 X:11357076-11357098 TGAAATTCCTCAGCAAGAAAAGG - Intronic
1188829708 X:34881444-34881466 TGGGTTTCTTCAGGAAGGAATGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193416934 X:81237106-81237128 TGGATTTCCTAGGGAAGAGATGG + Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195223778 X:102771375-102771397 TGGGGTTCCTTGGGCAGGAATGG + Intergenic
1196194068 X:112822171-112822193 TGGGAATCTTAGGGAAGGAACGG - Intronic
1199018209 X:142845184-142845206 TGTGATACCTTGGGTAGAAATGG - Intergenic
1199201487 X:145095094-145095116 TGGGATTTCACTGGGAGAAAGGG - Intergenic
1202036282 Y:20640196-20640218 TGGCATTCTTGGAGAAGAAAAGG - Intergenic