ID: 922441436

View in Genome Browser
Species Human (GRCh38)
Location 1:225658330-225658352
Sequence CTCCAAAACCATTCAGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922441436_922441438 -4 Left 922441436 1:225658330-225658352 CCATAGCCTGAATGGTTTTGGAG No data
Right 922441438 1:225658349-225658371 GGAGTAACATTAGTCTATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922441436 Original CRISPR CTCCAAAACCATTCAGGCTA TGG (reversed) Intergenic
No off target data available for this crispr