ID: 922449081

View in Genome Browser
Species Human (GRCh38)
Location 1:225722243-225722265
Sequence GAGTGTTGAATCCACCAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922449079_922449081 -10 Left 922449079 1:225722230-225722252 CCCAAGGCTTATAGAGTGTTGAA No data
Right 922449081 1:225722243-225722265 GAGTGTTGAATCCACCAGCACGG No data
922449077_922449081 3 Left 922449077 1:225722217-225722239 CCAGCACCACTATCCCAAGGCTT No data
Right 922449081 1:225722243-225722265 GAGTGTTGAATCCACCAGCACGG No data
922449078_922449081 -3 Left 922449078 1:225722223-225722245 CCACTATCCCAAGGCTTATAGAG No data
Right 922449081 1:225722243-225722265 GAGTGTTGAATCCACCAGCACGG No data
922449074_922449081 22 Left 922449074 1:225722198-225722220 CCTCCATACAGTGTCTCAACCAG No data
Right 922449081 1:225722243-225722265 GAGTGTTGAATCCACCAGCACGG No data
922449075_922449081 19 Left 922449075 1:225722201-225722223 CCATACAGTGTCTCAACCAGCAC No data
Right 922449081 1:225722243-225722265 GAGTGTTGAATCCACCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922449081 Original CRISPR GAGTGTTGAATCCACCAGCA CGG Intergenic
No off target data available for this crispr