ID: 922451099

View in Genome Browser
Species Human (GRCh38)
Location 1:225737953-225737975
Sequence GGTCCTGTAGACCAGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922451095_922451099 -7 Left 922451095 1:225737937-225737959 CCTTCCTCCTTCACCTGGTCCTG No data
Right 922451099 1:225737953-225737975 GGTCCTGTAGACCAGTGCCCAGG No data
922451087_922451099 28 Left 922451087 1:225737902-225737924 CCTGCCTTGGAGGATGAGGGTGA No data
Right 922451099 1:225737953-225737975 GGTCCTGTAGACCAGTGCCCAGG No data
922451089_922451099 24 Left 922451089 1:225737906-225737928 CCTTGGAGGATGAGGGTGAAGGG No data
Right 922451099 1:225737953-225737975 GGTCCTGTAGACCAGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922451099 Original CRISPR GGTCCTGTAGACCAGTGCCC AGG Intergenic
No off target data available for this crispr