ID: 922451175

View in Genome Browser
Species Human (GRCh38)
Location 1:225738651-225738673
Sequence AAATCAGTTGATCTGTCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922451175_922451182 20 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451182 1:225738694-225738716 TCCTTCCTGACAGGTTTGCTTGG No data
922451175_922451181 11 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451181 1:225738685-225738707 AAGGGAGGGTCCTTCCTGACAGG No data
922451175_922451179 -3 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451179 1:225738671-225738693 TTTTTTACCAAAATAAGGGAGGG No data
922451175_922451187 27 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451187 1:225738701-225738723 TGACAGGTTTGCTTGGGGACTGG No data
922451175_922451190 30 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451190 1:225738704-225738726 CAGGTTTGCTTGGGGACTGGGGG No data
922451175_922451184 21 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451184 1:225738695-225738717 CCTTCCTGACAGGTTTGCTTGGG No data
922451175_922451185 22 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451185 1:225738696-225738718 CTTCCTGACAGGTTTGCTTGGGG No data
922451175_922451177 -7 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451177 1:225738667-225738689 CTGATTTTTTACCAAAATAAGGG No data
922451175_922451176 -8 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451176 1:225738666-225738688 ACTGATTTTTTACCAAAATAAGG No data
922451175_922451189 29 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451189 1:225738703-225738725 ACAGGTTTGCTTGGGGACTGGGG No data
922451175_922451178 -4 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451178 1:225738670-225738692 ATTTTTTACCAAAATAAGGGAGG No data
922451175_922451188 28 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451188 1:225738702-225738724 GACAGGTTTGCTTGGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922451175 Original CRISPR AAATCAGTTGATCTGTCTAT AGG (reversed) Intergenic