ID: 922451180

View in Genome Browser
Species Human (GRCh38)
Location 1:225738678-225738700
Sequence GGAAGGACCCTCCCTTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922451180_922451185 -5 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451185 1:225738696-225738718 CTTCCTGACAGGTTTGCTTGGGG No data
922451180_922451189 2 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451189 1:225738703-225738725 ACAGGTTTGCTTGGGGACTGGGG No data
922451180_922451190 3 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451190 1:225738704-225738726 CAGGTTTGCTTGGGGACTGGGGG No data
922451180_922451184 -6 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451184 1:225738695-225738717 CCTTCCTGACAGGTTTGCTTGGG No data
922451180_922451188 1 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451188 1:225738702-225738724 GACAGGTTTGCTTGGGGACTGGG No data
922451180_922451187 0 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451187 1:225738701-225738723 TGACAGGTTTGCTTGGGGACTGG No data
922451180_922451182 -7 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451182 1:225738694-225738716 TCCTTCCTGACAGGTTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922451180 Original CRISPR GGAAGGACCCTCCCTTATTT TGG (reversed) Intergenic