ID: 922451182

View in Genome Browser
Species Human (GRCh38)
Location 1:225738694-225738716
Sequence TCCTTCCTGACAGGTTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922451180_922451182 -7 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451182 1:225738694-225738716 TCCTTCCTGACAGGTTTGCTTGG No data
922451175_922451182 20 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451182 1:225738694-225738716 TCCTTCCTGACAGGTTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922451182 Original CRISPR TCCTTCCTGACAGGTTTGCT TGG Intergenic