ID: 922451184 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:225738695-225738717 |
Sequence | CCTTCCTGACAGGTTTGCTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
922451175_922451184 | 21 | Left | 922451175 | 1:225738651-225738673 | CCTATAGACAGATCAACTGATTT | No data | ||
Right | 922451184 | 1:225738695-225738717 | CCTTCCTGACAGGTTTGCTTGGG | No data | ||||
922451180_922451184 | -6 | Left | 922451180 | 1:225738678-225738700 | CCAAAATAAGGGAGGGTCCTTCC | No data | ||
Right | 922451184 | 1:225738695-225738717 | CCTTCCTGACAGGTTTGCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
922451184 | Original CRISPR | CCTTCCTGACAGGTTTGCTT GGG | Intergenic | ||