ID: 922451184

View in Genome Browser
Species Human (GRCh38)
Location 1:225738695-225738717
Sequence CCTTCCTGACAGGTTTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922451175_922451184 21 Left 922451175 1:225738651-225738673 CCTATAGACAGATCAACTGATTT No data
Right 922451184 1:225738695-225738717 CCTTCCTGACAGGTTTGCTTGGG No data
922451180_922451184 -6 Left 922451180 1:225738678-225738700 CCAAAATAAGGGAGGGTCCTTCC No data
Right 922451184 1:225738695-225738717 CCTTCCTGACAGGTTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922451184 Original CRISPR CCTTCCTGACAGGTTTGCTT GGG Intergenic