ID: 922451185 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:225738696-225738718 |
| Sequence | CTTCCTGACAGGTTTGCTTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 922451180_922451185 | -5 | Left | 922451180 | 1:225738678-225738700 | CCAAAATAAGGGAGGGTCCTTCC | 0: 1 1: 0 2: 0 3: 6 4: 84 |
||
| Right | 922451185 | 1:225738696-225738718 | CTTCCTGACAGGTTTGCTTGGGG | No data | ||||
| 922451175_922451185 | 22 | Left | 922451175 | 1:225738651-225738673 | CCTATAGACAGATCAACTGATTT | 0: 1 1: 0 2: 1 3: 13 4: 145 |
||
| Right | 922451185 | 1:225738696-225738718 | CTTCCTGACAGGTTTGCTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 922451185 | Original CRISPR | CTTCCTGACAGGTTTGCTTG GGG | Intergenic | ||