ID: 922455465

View in Genome Browser
Species Human (GRCh38)
Location 1:225770490-225770512
Sequence CGGTAGGGAAGGTGGGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922455465_922455474 24 Left 922455465 1:225770490-225770512 CCCCTTTCCCACCTTCCCTACCG No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455465_922455476 25 Left 922455465 1:225770490-225770512 CCCCTTTCCCACCTTCCCTACCG No data
Right 922455476 1:225770538-225770560 CCTGCCGCTGTTTGCTAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922455465 Original CRISPR CGGTAGGGAAGGTGGGAAAG GGG (reversed) Intergenic
No off target data available for this crispr