ID: 922455474

View in Genome Browser
Species Human (GRCh38)
Location 1:225770537-225770559
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922455466_922455474 23 Left 922455466 1:225770491-225770513 CCCTTTCCCACCTTCCCTACCGT No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455472_922455474 8 Left 922455472 1:225770506-225770528 CCTACCGTGCTTCTTTGTCAATT No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455473_922455474 4 Left 922455473 1:225770510-225770532 CCGTGCTTCTTTGTCAATTAACA No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455470_922455474 13 Left 922455470 1:225770501-225770523 CCTTCCCTACCGTGCTTCTTTGT No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455469_922455474 16 Left 922455469 1:225770498-225770520 CCACCTTCCCTACCGTGCTTCTT No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455467_922455474 22 Left 922455467 1:225770492-225770514 CCTTTCCCACCTTCCCTACCGTG No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455468_922455474 17 Left 922455468 1:225770497-225770519 CCCACCTTCCCTACCGTGCTTCT No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455471_922455474 9 Left 922455471 1:225770505-225770527 CCCTACCGTGCTTCTTTGTCAAT No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455464_922455474 25 Left 922455464 1:225770489-225770511 CCCCCTTTCCCACCTTCCCTACC No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data
922455465_922455474 24 Left 922455465 1:225770490-225770512 CCCCTTTCCCACCTTCCCTACCG No data
Right 922455474 1:225770537-225770559 TCCTGCCGCTGTTTGCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr