ID: 922455573

View in Genome Browser
Species Human (GRCh38)
Location 1:225771106-225771128
Sequence CTCAATGCTGCCTCCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922455573_922455580 0 Left 922455573 1:225771106-225771128 CCCCCAGAGGAGGCAGCATTGAG No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922455573 Original CRISPR CTCAATGCTGCCTCCTCTGG GGG (reversed) Intergenic
No off target data available for this crispr