ID: 922455580

View in Genome Browser
Species Human (GRCh38)
Location 1:225771129-225771151
Sequence GGTGGCCTTTGCGATACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922455572_922455580 7 Left 922455572 1:225771099-225771121 CCAGCTTCCCCCAGAGGAGGCAG No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data
922455576_922455580 -2 Left 922455576 1:225771108-225771130 CCCAGAGGAGGCAGCATTGAGGG No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data
922455568_922455580 13 Left 922455568 1:225771093-225771115 CCTGACCCAGCTTCCCCCAGAGG No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data
922455574_922455580 -1 Left 922455574 1:225771107-225771129 CCCCAGAGGAGGCAGCATTGAGG No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data
922455571_922455580 8 Left 922455571 1:225771098-225771120 CCCAGCTTCCCCCAGAGGAGGCA No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data
922455573_922455580 0 Left 922455573 1:225771106-225771128 CCCCCAGAGGAGGCAGCATTGAG No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data
922455578_922455580 -3 Left 922455578 1:225771109-225771131 CCAGAGGAGGCAGCATTGAGGGT No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data
922455567_922455580 18 Left 922455567 1:225771088-225771110 CCTGGCCTGACCCAGCTTCCCCC No data
Right 922455580 1:225771129-225771151 GGTGGCCTTTGCGATACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922455580 Original CRISPR GGTGGCCTTTGCGATACCCA AGG Intergenic
No off target data available for this crispr