ID: 922457115

View in Genome Browser
Species Human (GRCh38)
Location 1:225784018-225784040
Sequence CTAGAGAAGCACATATATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922457115_922457119 15 Left 922457115 1:225784018-225784040 CCCATATATATGTGCTTCTCTAG 0: 1
1: 0
2: 1
3: 20
4: 159
Right 922457119 1:225784056-225784078 TGTCTTTTCATAACAGCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922457115 Original CRISPR CTAGAGAAGCACATATATAT GGG (reversed) Intronic
903868452 1:26414877-26414899 CTTGAGAAACACAGTTATATAGG + Intronic
905054384 1:35080297-35080319 AAAAAGAAGCACAAATATATGGG - Intronic
906074185 1:43039935-43039957 TTAAAGAACCACATGTATATAGG + Intergenic
908428906 1:64036642-64036664 CTAGAAAAGCAGACATTTATTGG - Intronic
911922962 1:103790649-103790671 CTAGAGAATCACATTTTGATAGG - Intergenic
914454232 1:147820678-147820700 CCAGAGAAGAACAGATGTATGGG + Intergenic
914784552 1:150816759-150816781 GTAAAGCAGCACATATATACGGG + Intronic
916657415 1:166888433-166888455 CAAGAGAAACACATATATTTGGG - Intergenic
918579262 1:186106611-186106633 CTAAAAAGGCAGATATATATAGG - Intronic
922457115 1:225784018-225784040 CTAGAGAAGCACATATATATGGG - Intronic
922556739 1:226538349-226538371 CTACAGAAGTACATATGTATTGG + Intergenic
923308355 1:232709389-232709411 CTGGAGAAGCACTTATTTTTAGG + Intergenic
1068591148 10:58854524-58854546 CTTGAGAAGCACTTATTTACAGG - Intergenic
1069483258 10:68803113-68803135 CTATCCAAGCACATAAATATTGG - Intergenic
1079776622 11:24539671-24539693 TGACAGAAGTACATATATATAGG + Intronic
1079790735 11:24735820-24735842 CTAGAATAGCAGATATAGATTGG + Intronic
1080132509 11:28813563-28813585 CAAGAGAAGCAGACATATTTTGG - Intergenic
1080990814 11:37532497-37532519 ATAGAGAAGCACAAAGACATGGG - Intergenic
1083522474 11:63327951-63327973 CTTGACAAGCTCATATGTATTGG - Intronic
1085718567 11:78893900-78893922 TCAGATAAGCATATATATATTGG - Intronic
1085887117 11:80533883-80533905 TTAGTGAAGCAAATATTTATTGG + Intergenic
1086858568 11:91897141-91897163 CTAGAGATGCACATGCATAGAGG - Intergenic
1087518912 11:99204015-99204037 CTACAGAAGCAAATTTATTTTGG - Intronic
1088192652 11:107242693-107242715 CGAGAGAAGCTCATACATGTAGG + Intergenic
1088612850 11:111594758-111594780 CTAGAGAAGCACAAAAATAAGGG + Intergenic
1093861400 12:24171686-24171708 CTAGAGAAGCATATAAAGAAGGG + Intergenic
1094824518 12:34259151-34259173 CTAGAGAAGCAGCTATATTCAGG + Intergenic
1096883407 12:54692365-54692387 ATACAGAAGCACACATACATAGG + Intergenic
1098785826 12:74753438-74753460 ATAGAGATATACATATATATAGG - Intergenic
1098860230 12:75701355-75701377 CTAGGGAAGCACATAGAAACAGG - Intergenic
1100085598 12:90906368-90906390 TTAGAGAAGCAAATATCTCTGGG - Intronic
1101145237 12:101834496-101834518 CTGGAGGGGCATATATATATTGG + Intergenic
1101451546 12:104784332-104784354 ATAGATACACACATATATATAGG + Intergenic
1103905073 12:124323000-124323022 CAAGAGAATCACATATACACAGG - Intergenic
1110091580 13:71455389-71455411 CTACTGAAGAAGATATATATAGG - Intronic
1110981157 13:81900118-81900140 ATCCAGAAGCACATATATAATGG + Intergenic
1111447256 13:88363500-88363522 TTAAAGTAGCACATATATTTGGG - Intergenic
1111520169 13:89390964-89390986 GTAAAGAATCACATAAATATTGG + Intergenic
1115844339 14:37509575-37509597 CTATATATGTACATATATATAGG - Intronic
1117060742 14:51960088-51960110 CTAAAGAAGCAGAGAGATATGGG - Intronic
1120110945 14:80555479-80555501 TTAAAGAACCACACATATATAGG - Intronic
1120826036 14:88956457-88956479 ATAGAAAAGTACCTATATATAGG - Intergenic
1120871810 14:89344558-89344580 TTAGAGAGTGACATATATATGGG - Intronic
1122045294 14:99018599-99018621 CCAAAGGAGCACATATATTTTGG + Intergenic
1126523044 15:49618907-49618929 GTAGAGAAACACACACATATTGG - Intronic
1126892618 15:53222664-53222686 CTAGATAAGCACATTTATCTAGG + Intergenic
1127305684 15:57703757-57703779 CTAGAGAAGAAGATATAAAATGG - Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1135492576 16:22922694-22922716 CCAGAGACGCACAGTTATATTGG + Intergenic
1136924294 16:34357509-34357531 CTAGGGAGACACATAGATATTGG + Intergenic
1136980279 16:35054297-35054319 CTAGGGAGACACATAGATATTGG - Intergenic
1137999287 16:53257617-53257639 ATAGAGAAGGACATTTATATGGG + Intronic
1139057405 16:63201883-63201905 CTTGAGAAACAGATATAAATAGG - Intergenic
1140192127 16:72827010-72827032 TTAGAGAGGCACATATAGAGTGG + Intronic
1141536510 16:84684866-84684888 TTAGAGAAGCACAAAAAGATGGG - Intergenic
1144481863 17:15636356-15636378 CTTGAGAAACACATATATTAGGG + Intronic
1203182660 17_KI270729v1_random:77865-77887 TTTGAGAAACACATATCTATAGG + Intergenic
1155994510 18:32316117-32316139 CTTCAGAATCACATATACATGGG + Intronic
1158131106 18:54153518-54153540 TTAGAAAAGCACATATATCTTGG + Exonic
1164394181 19:27849721-27849743 CTACAGCAGTACATATATATTGG + Intergenic
1165929683 19:39348824-39348846 GTAGAGAAGCAGATATATTTTGG + Intronic
925635771 2:5940534-5940556 TTAGAGAAGAACATATCTATGGG - Intergenic
925881467 2:8356378-8356400 CTACAGAAGGACATAAGTATTGG - Intergenic
927014004 2:18937025-18937047 AGAGAGAGGCATATATATATAGG + Intergenic
928249683 2:29664573-29664595 CAATAGAAGGACATAAATATGGG - Intronic
933209291 2:79548553-79548575 CTAGAGAATCACATCTGTTTGGG + Intronic
935128682 2:100245337-100245359 CTATAGAAGCACATACAAAATGG - Intergenic
937367122 2:121271318-121271340 CTATGGAAGCAGATATATATGGG + Intronic
941144551 2:161827863-161827885 ATAAAGAATCACATAAATATTGG - Intronic
941401277 2:165034115-165034137 CTATAGAAGTACATGCATATGGG - Intergenic
943150408 2:184105652-184105674 CAAGAGAAGAACTTATATAAGGG - Intergenic
943395774 2:187330816-187330838 CTAGAGAAGATAAAATATATAGG - Intergenic
944604649 2:201341496-201341518 CTACACAAGCATATATATATAGG + Intronic
945141063 2:206686635-206686657 CTGGAGAAGACCATGTATATAGG + Intronic
946735050 2:222745566-222745588 CTTGAAAAGCACATATTCATTGG + Intergenic
946867482 2:224055445-224055467 GTAGAGGAGCACATAGATATTGG - Intergenic
947757810 2:232580831-232580853 ATACAGAAGCACACATATACAGG - Intronic
1168747953 20:260288-260310 CAAGAGAAGCACAAAGTTATGGG + Exonic
1169748742 20:8969737-8969759 TTAGAAAAGCACATATAAAAAGG - Intergenic
1171322669 20:24260192-24260214 CTGGAGAAGGACATATATCAGGG + Intergenic
1172550361 20:35794331-35794353 CAAGATAAGCACATACATAAGGG - Intronic
1173840615 20:46154418-46154440 CTTAATAAGCACATATTTATTGG + Intergenic
1176640130 21:9294703-9294725 CTAGAGAAGCACACATCATTTGG + Intergenic
1177894170 21:26841571-26841593 CTAGAGAAAGAAATATATTTAGG + Intronic
1178691077 21:34750637-34750659 AGACAAAAGCACATATATATTGG - Intergenic
1178769273 21:35487864-35487886 CTGGATAAGCACATAAATAAGGG - Intronic
1180349146 22:11784086-11784108 CTAGAGAAGCACACATCATTTGG + Intergenic
1180373434 22:12067540-12067562 CTAGAGAAGCACACATCATTTGG + Intergenic
1180424177 22:12902166-12902188 CTAGAGAAGCACACATCATTTGG + Intergenic
1181287851 22:21767298-21767320 CTAGAGAGCCACATGTGTATGGG + Intronic
950309456 3:11944041-11944063 CTAGAGAGGCAAATACATACTGG + Intergenic
950909211 3:16570819-16570841 ATAGAAAAGTACATATATCTAGG + Intergenic
951181670 3:19666197-19666219 CTAGACATGCATATATAGATTGG + Intergenic
952961206 3:38590276-38590298 CTTGAGAAGTACATACATTTTGG + Intronic
953663984 3:44912414-44912436 CCAGAGACCCAGATATATATGGG - Intronic
955489042 3:59464145-59464167 CTAGGGAAGCACCTAGAGATAGG - Intergenic
959464844 3:106672728-106672750 ATAGATAAGCATACATATATAGG + Intergenic
960355555 3:116648508-116648530 CCAGAGAAACAGAAATATATAGG - Intronic
961972009 3:130978006-130978028 CTAAAGAAGCAAATAAATACAGG + Intronic
962776395 3:138664617-138664639 TTAGAAAAGCACTAATATATAGG - Intronic
963763725 3:149311114-149311136 CAAGAGAAGCACTTCTATGTAGG + Intergenic
964027224 3:152090317-152090339 CAAGAGAAGCATATAGATAATGG - Intergenic
964691662 3:159456571-159456593 CTAGAGCAGCATTTATACATAGG - Intronic
967024442 3:185552079-185552101 CTAGAAAGGCACAGATAAATAGG + Intronic
968010712 3:195272241-195272263 CTAGGGTAGTACATATATTTAGG - Intergenic
1202746764 3_GL000221v1_random:110319-110341 CTAGAGAAGCACACATCATTTGG - Intergenic
969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG + Intergenic
970456478 4:16227618-16227640 CTTGAGAACCGCATATAAATGGG + Intergenic
971981830 4:33761576-33761598 CTAGATATGTACATATATATGGG + Intergenic
972389157 4:38596759-38596781 CTAAAGAAGTACTTATATAAGGG + Intergenic
974119201 4:57618309-57618331 ATATAGATGCACATATACATAGG - Intergenic
977138487 4:93337111-93337133 ATAGAGAAGTAAATAAATATAGG + Intronic
977759405 4:100713737-100713759 AAAGAGAAGCAAATACATATAGG - Intronic
978485135 4:109244860-109244882 CTAGAGATCCACATATTTATTGG - Intronic
979476557 4:121165154-121165176 CGAGATATTCACATATATATAGG + Intronic
982812243 4:159840381-159840403 GAAGAGAAGCAAATACATATAGG + Intergenic
984152095 4:176146216-176146238 CTAGAAATGTACATATTTATAGG + Intronic
984380059 4:178981594-178981616 CTATATAAGCAGAAATATATAGG - Intergenic
986412916 5:7499623-7499645 CTAAAGAAGTACATATATGTGGG + Intronic
986420893 5:7580648-7580670 ATGGAGAAGAACATATATTTGGG + Intronic
987024923 5:13916997-13917019 CAAGAAAATTACATATATATAGG - Intronic
992975099 5:82108371-82108393 ATATATATGCACATATATATAGG - Intronic
994284176 5:97943430-97943452 CTATAGAAATACATATATTTTGG + Intergenic
994709260 5:103246377-103246399 CTAGAGAAACAAACATATTTAGG - Intergenic
995231251 5:109766503-109766525 CTAAAGAAGAACATAGACATGGG - Intronic
996476113 5:123922933-123922955 ATAGACACACACATATATATTGG - Intergenic
997962483 5:138332956-138332978 CTTGAGAAGCACAGATATGATGG - Intronic
998967282 5:147554230-147554252 CTAAAAAAGCACATAGATTTAGG + Intergenic
999577466 5:152995440-152995462 CAAGAGAATGACATATATAAAGG + Intergenic
999715601 5:154357630-154357652 CTGGAGAAGCAGATTTTTATGGG - Intronic
1000664063 5:163972529-163972551 CTAGAGAAGTACAGATTTATGGG - Intergenic
1001717953 5:173832429-173832451 CTTGAGAAGCACAGATCTACAGG - Intergenic
1002452670 5:179327966-179327988 ATAGAGAAACTCATATATCTGGG + Intronic
1006442790 6:34062605-34062627 CCTGAGAAGCACATGGATATGGG - Intronic
1011799311 6:90992992-90993014 CTGGAGAAGAACAGATATATAGG + Intergenic
1011896512 6:92233956-92233978 TTATAGAAGCACATTAATATTGG - Intergenic
1013453330 6:110306451-110306473 ATAGAGAAACACTTGTATATAGG - Intronic
1013827310 6:114229849-114229871 CCAGAGAAACACAAAGATATAGG + Intronic
1014595716 6:123335300-123335322 CTAGAAAATTACATATATAAAGG - Intronic
1014639078 6:123886618-123886640 ATAGAAAAGCAGTTATATATTGG - Intronic
1014783958 6:125596948-125596970 CAAGACAAACACATATACATGGG + Intergenic
1014984908 6:127993291-127993313 ATAGATACACACATATATATAGG + Intronic
1016729432 6:147412632-147412654 ATAGATAAGCACATATATATAGG + Intergenic
1020477417 7:8613805-8613827 CTAGAAAGGAACATATATCTTGG + Intronic
1020735271 7:11941138-11941160 CTAGAGAAGCACAGAGCTATAGG + Intergenic
1023782517 7:43670048-43670070 CTAGAGTAACACAAATATAAAGG + Intronic
1024705328 7:51952064-51952086 CTAGATAAAAACATGTATATTGG + Intergenic
1027514138 7:79120859-79120881 CCAGAGAAGTATATATAAATGGG - Intronic
1030076951 7:105745262-105745284 GTATAGATACACATATATATAGG + Intronic
1031851058 7:126864598-126864620 CTATATAGGCATATATATATAGG - Intronic
1035211491 7:157331932-157331954 CAAGTAAAGCACTTATATATAGG + Intergenic
1038302642 8:26368804-26368826 CTTGAAAAATACATATATATAGG + Intronic
1039249960 8:35651986-35652008 CTAGAGAATCACCTATACATTGG - Intronic
1041278208 8:56185618-56185640 CTAGAAAAGGATATATATCTAGG + Intronic
1043326397 8:79057138-79057160 CTAGTGAAACACATATGTACTGG - Intergenic
1044229032 8:89753998-89754020 ATAAACATGCACATATATATAGG - Intergenic
1048601128 8:135919911-135919933 CTAGAGAAGCACAAAAAGAAGGG + Intergenic
1050177266 9:2881230-2881252 CAACAGAAGCACTTATATATTGG - Intergenic
1050262781 9:3858294-3858316 ATATAGAATCATATATATATAGG - Intronic
1050334586 9:4578041-4578063 TAAGAGAAGCACATATAGGTGGG + Intronic
1051959918 9:22746834-22746856 CTTTAGAAACAAATATATATAGG + Intergenic
1052648511 9:31270092-31270114 GAAGAGAGGCACATTTATATAGG + Intergenic
1055361722 9:75498024-75498046 CATGATAAGTACATATATATTGG + Intergenic
1056653053 9:88485227-88485249 TTACAGATACACATATATATGGG + Intergenic
1057849490 9:98553916-98553938 CTAGAGAAGTAAATATGTTTTGG - Intronic
1057959980 9:99445851-99445873 ACAGAGAAGCAGCTATATATAGG + Intergenic
1058304429 9:103419720-103419742 TTAAAGAAGCACATAGATGTTGG + Intergenic
1059014057 9:110494859-110494881 CTAGAGAATCACATCAATTTTGG + Intronic
1059275178 9:113090281-113090303 CTAGAGAAGGACAAATGAATAGG + Intergenic
1060231102 9:121826230-121826252 ATATACACGCACATATATATGGG + Intronic
1060331732 9:122677411-122677433 CTAGAGATGCATATATTTCTAGG + Intergenic
1203715403 Un_KI270742v1:140412-140434 CTAGAGAAGCACACATCATTTGG - Intergenic
1188839158 X:34993669-34993691 CTATAAAATGACATATATATGGG - Intergenic
1194299871 X:92172700-92172722 TTAAAGAAGAACATTTATATGGG + Intronic
1196801107 X:119544114-119544136 ATATAGATGCACATATTTATGGG - Intronic
1197512516 X:127388063-127388085 GTAGAGAAGCAGAGCTATATAGG + Intergenic
1197989047 X:132297236-132297258 GTTCAGAAGAACATATATATAGG - Intergenic
1199850056 X:151719690-151719712 CAAGAGGAGCACACAGATATTGG - Intronic
1200337037 X:155361827-155361849 GTTGTGAAGCACAGATATATTGG + Intergenic
1200349433 X:155479400-155479422 GTTGTGAAGCACAGATATATTGG - Intergenic
1200617542 Y:5397997-5398019 TTAAAGAAGAACATTTATATGGG + Intronic