ID: 922461271

View in Genome Browser
Species Human (GRCh38)
Location 1:225816000-225816022
Sequence TGCCAAGGACTGGCCCGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922461263_922461271 15 Left 922461263 1:225815962-225815984 CCCCTGGAATAGGAGCCTCTCTC 0: 1
1: 0
2: 0
3: 19
4: 216
Right 922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG 0: 1
1: 0
2: 0
3: 30
4: 282
922461265_922461271 13 Left 922461265 1:225815964-225815986 CCTGGAATAGGAGCCTCTCTCCA 0: 1
1: 0
2: 1
3: 20
4: 174
Right 922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG 0: 1
1: 0
2: 0
3: 30
4: 282
922461264_922461271 14 Left 922461264 1:225815963-225815985 CCCTGGAATAGGAGCCTCTCTCC 0: 1
1: 0
2: 1
3: 8
4: 161
Right 922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG 0: 1
1: 0
2: 0
3: 30
4: 282
922461266_922461271 0 Left 922461266 1:225815977-225815999 CCTCTCTCCACTCAAGTAGAGAA 0: 1
1: 0
2: 1
3: 15
4: 192
Right 922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG 0: 1
1: 0
2: 0
3: 30
4: 282
922461262_922461271 23 Left 922461262 1:225815954-225815976 CCTATTATCCCCTGGAATAGGAG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG 0: 1
1: 0
2: 0
3: 30
4: 282
922461267_922461271 -7 Left 922461267 1:225815984-225816006 CCACTCAAGTAGAGAATGCCAAG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG 0: 1
1: 0
2: 0
3: 30
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922461271 Original CRISPR TGCCAAGGACTGGCCCGGCA TGG Intronic
900328079 1:2120584-2120606 AGCCAAGGGCTGGCCGGGCACGG - Intronic
900379551 1:2377128-2377150 TGCCAGGCAGTGGCCCAGCAGGG - Intronic
900793777 1:4695400-4695422 GGCCAACGGCTGGCCAGGCAAGG + Intronic
900963965 1:5944677-5944699 TACCAATGACTGGCCGGGCGCGG + Intronic
901319027 1:8328435-8328457 AGCCCAGCACTCGCCCGGCATGG - Intronic
901795646 1:11677767-11677789 GGCTAAGAACTGGCCGGGCATGG + Intronic
901845653 1:11980508-11980530 TGGCGGGGACTGGCCCGGCCCGG + Intronic
902361212 1:15943558-15943580 TGCCCAGGACTGGGAGGGCACGG - Intronic
902481109 1:16712328-16712350 TGCCAAGTACGGGCCAGGCTGGG + Intergenic
902552329 1:17226507-17226529 TGCCAAGCACTGTCCAGGCAGGG + Intronic
903457072 1:23494986-23495008 TGCAGATGACTGGCCAGGCATGG - Intergenic
903689684 1:25164004-25164026 GGCCAAGGGCTGGCTAGGCAGGG + Intergenic
903886929 1:26546132-26546154 GGCCCAGGCCTGGCCCTGCAGGG + Intronic
903939111 1:26916666-26916688 AACCAAGAACTGGCCGGGCACGG + Intronic
904403827 1:30273621-30273643 TGCCAAGGGTGGGCCAGGCATGG + Intergenic
906191520 1:43902273-43902295 AGCCAAGGCCTGGCAGGGCAGGG + Intronic
909444803 1:75737140-75737162 AGCCAAGAACAGGCCAGGCATGG + Intronic
910256770 1:85256507-85256529 TGAAAAGGAATGGCCGGGCACGG + Intronic
911025171 1:93427886-93427908 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
912531123 1:110323232-110323254 TCCCAAGAATTGGCCAGGCACGG - Intergenic
915464059 1:156085763-156085785 AGCCAAGGTCTGGCAGGGCATGG + Intronic
916003683 1:160639802-160639824 TGCCACGGACTGGGCATGCAGGG - Intronic
916036974 1:160930979-160931001 TACCAAGGATTGGCCAGGCATGG - Intergenic
918364863 1:183797037-183797059 TGCCAACAATTGGCCGGGCACGG + Intronic
920045563 1:203130040-203130062 TGCCAGGGACTGGCCCTGCTGGG + Intronic
922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG + Intronic
922481508 1:225942665-225942687 AGCCACGACCTGGCCCGGCACGG - Intergenic
923008570 1:230070737-230070759 TACCATGGTCTAGCCCGGCAAGG - Intronic
923504147 1:234591228-234591250 TCCCATGGACTTGCCCGACATGG + Intergenic
1063465652 10:6242384-6242406 TGCCCAGGACGGGCCTGGCCAGG + Intergenic
1064153546 10:12885285-12885307 TGAGAAGGACTGGCCAGGCGTGG - Intergenic
1065830485 10:29609828-29609850 TGCCAAGGGCAAGCCAGGCATGG - Intronic
1066096703 10:32079022-32079044 TGACAAAAACTGGCCAGGCATGG + Intergenic
1066508345 10:36067538-36067560 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1068996544 10:63212153-63212175 TGCCAAGGGCTGGCAGGGAAGGG + Intronic
1070955021 10:80458052-80458074 ATCCAAGGACTGACACGGCAGGG - Intronic
1073308307 10:102520508-102520530 ACCCAAGAACTGGCCAGGCACGG - Intronic
1074066427 10:110018785-110018807 TGCCAAGGACTGGCCTCCCTAGG + Intronic
1074083033 10:110182787-110182809 TGCCAATTGCTGGCCAGGCATGG + Intergenic
1074416267 10:113269571-113269593 GGCCAAGGAGTGGCCTGGCAGGG - Intergenic
1074447230 10:113530537-113530559 TGCCCAGGAAGGGCCCTGCAGGG + Intergenic
1074528196 10:114279113-114279135 AGCCAAGTGCTGGCCCTGCAGGG + Intronic
1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG + Intergenic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1075823167 10:125331300-125331322 AGCCAAGGCCAGGCCAGGCATGG + Intergenic
1076736636 10:132462028-132462050 GCCCAAGGAGGGGCCCGGCAGGG - Intergenic
1077158895 11:1103697-1103719 TGCCCAGGACCGGCCAGCCAGGG - Intergenic
1077376756 11:2208903-2208925 TGCCCAGTCCTGGTCCGGCATGG + Intergenic
1078564434 11:12402303-12402325 TGCCAATGTGTGGCCCAGCAGGG + Intronic
1080658733 11:34278677-34278699 TGACAAGCACAGGCCCTGCAGGG - Intronic
1080665236 11:34330126-34330148 GGCCAAGGAGTGACCCAGCAGGG - Intronic
1083363334 11:62126484-62126506 AACCAAGAACTGGCCGGGCACGG - Intronic
1083593338 11:63907714-63907736 TGCCAAGGCCTGGGTCTGCATGG - Intronic
1083651806 11:64208539-64208561 GGCCAGGGACTGGCCCGGGGCGG - Intronic
1083870072 11:65481793-65481815 TGCCAAGGAATGACTCAGCAAGG + Intergenic
1084051826 11:66605169-66605191 CCCCAAGGACTGGGCAGGCAAGG - Intronic
1084150586 11:67286218-67286240 TGCCCAGGACGGGGCCGGCCAGG + Exonic
1084434558 11:69131320-69131342 TGCCCAGGGGTGGCCCGGAAAGG + Intergenic
1084511106 11:69604698-69604720 TTCCAAGAAGTGGCCAGGCACGG + Intergenic
1087419112 11:97898116-97898138 TGACAATGACAGGCCGGGCACGG + Intergenic
1087667157 11:101064037-101064059 CCCCAAGGAATGGCCAGGCATGG + Intronic
1089683481 11:120132471-120132493 TGCCAGGAACGGGCCCTGCATGG + Intronic
1090060752 11:123462255-123462277 AACAAATGACTGGCCCGGCACGG - Intergenic
1090705439 11:129332117-129332139 TGCCAAGGCCTGGGCCTGCATGG - Intergenic
1090778974 11:129990046-129990068 TTCCAAAAACTGGCCAGGCATGG + Intronic
1091292735 11:134451159-134451181 AGTGAATGACTGGCCCGGCATGG - Intergenic
1092533701 12:9366645-9366667 AGCCAAGGAGAGGCCGGGCAAGG - Intergenic
1094176487 12:27546857-27546879 TGCAAAAAACTGGCCAGGCATGG + Intronic
1094357851 12:29597363-29597385 TCACATGGACTGGCCAGGCATGG - Intronic
1098951727 12:76646163-76646185 TGCCAAGGCCAAGCCAGGCATGG - Intergenic
1100391656 12:94149742-94149764 TGCCACCGGCTGGCCCAGCATGG + Exonic
1101093825 12:101315193-101315215 TGGCTAGAACTGGCCAGGCACGG + Intronic
1106289114 13:28344187-28344209 CGGCAAGGCCTGGCCAGGCAGGG - Intronic
1107365029 13:39662415-39662437 TATAAAGGACTGGCCGGGCATGG - Intronic
1109468233 13:62767649-62767671 TGCCAAGGAAGAGCCAGGCATGG + Intergenic
1110810796 13:79808723-79808745 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1111129161 13:83952205-83952227 TACAAAAGACTGGCCGGGCAAGG + Intergenic
1111595532 13:90404988-90405010 TGCCAAGGACATGCTAGGCATGG - Intergenic
1113485623 13:110650518-110650540 TGTCTAGCACTGGCCTGGCATGG - Intronic
1114736688 14:25049897-25049919 TGCCGCGCACTGGCACGGCAGGG - Exonic
1115745316 14:36430506-36430528 TGCTAAGGAATGGGCTGGCACGG + Intergenic
1119393272 14:74305924-74305946 TCCCAAACACTGGCCCGGCTTGG - Intronic
1119537711 14:75416548-75416570 ACCCAAGGAGTGGCCAGGCATGG + Intergenic
1119539270 14:75428125-75428147 TGCCCAGGCCTGTCCCGGCCCGG - Intronic
1119646953 14:76354999-76355021 AGCCCAGGACCGGCCGGGCATGG - Intronic
1120942209 14:89959238-89959260 TACCAAGCACTGCCCAGGCAGGG + Intronic
1120955375 14:90077409-90077431 TTCCCAGGATTGGCCGGGCATGG - Intronic
1122268039 14:100555830-100555852 TGCCCAGGCCTGGGCGGGCACGG - Intronic
1123041817 14:105493342-105493364 TGCCAAGGCCAGGCCCGACGGGG - Intronic
1124794143 15:32760450-32760472 TGCCCAGGATGGGCCAGGCACGG - Intergenic
1125503438 15:40253181-40253203 TGCGGAGGACTGGCCCAGCAAGG + Exonic
1125872829 15:43117652-43117674 AGCCAAAGACAGGCCGGGCATGG + Intronic
1126132101 15:45351977-45351999 TGCCAATGACTGGTCAGGAATGG + Intergenic
1126215340 15:46147188-46147210 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1126497329 15:49306635-49306657 TGCCTAGGGCTGGCCTGGCCTGG - Intronic
1128123757 15:65174551-65174573 TACCAAGTTGTGGCCCGGCATGG - Intronic
1128698954 15:69789959-69789981 TGCCAGGGAGTGGCCCAGCCAGG + Intergenic
1129162398 15:73753740-73753762 TGCCAAGCTCTGGGTCGGCAGGG + Intergenic
1130013885 15:80173042-80173064 TCCCAAGGAATGGCCCGAGAGGG - Exonic
1130337937 15:82973773-82973795 AGCCAATGTCTGGCCAGGCATGG + Intronic
1130907641 15:88251712-88251734 TGGCAGGGACTGGCAAGGCAAGG + Intronic
1131565736 15:93483858-93483880 TTCCAAGGACTGGGGTGGCAGGG - Intergenic
1131586770 15:93703968-93703990 TGCCAAGGATTGGCCAGGCGTGG + Intergenic
1132625190 16:888217-888239 TGCCAGGGCCTGGGCGGGCAGGG - Intronic
1133336078 16:5007488-5007510 TGCCAGGGCCTGGCCGGGGAGGG + Intronic
1136294408 16:29293434-29293456 TGCCCAGGGCTGGCCCACCATGG + Intergenic
1136651951 16:31680615-31680637 CTCCAAGGACTGGCCTGGAAGGG - Intergenic
1139364560 16:66425895-66425917 GGCCAGGGACTGGCCTTGCAGGG - Intergenic
1139463504 16:67141554-67141576 TGCCAAGGGCAAGCCAGGCATGG + Intronic
1139496187 16:67320228-67320250 TGGAAAGGATTGGCCGGGCATGG + Intronic
1140405463 16:74707957-74707979 TTCCAAAGACTAGCCAGGCACGG - Intergenic
1142746907 17:1964014-1964036 TCCCAAGGGCAGGCCCGGCGCGG - Intronic
1142822311 17:2479894-2479916 AGTAAAGGACTGGCCGGGCACGG + Intronic
1142872269 17:2828621-2828643 GGCCCAGGACTGCCCGGGCATGG + Intronic
1143009837 17:3860028-3860050 TGCCAAGGTCTGGTCCGGGTAGG - Intergenic
1143595971 17:7914252-7914274 TGCCAGAGTCTGGCCCGGCGCGG + Intergenic
1144781613 17:17811062-17811084 TGGCAGGGACTGGCCCGGGCCGG - Exonic
1145957170 17:28862489-28862511 TGCCTAGCACTGCCCTGGCAAGG + Intergenic
1146087063 17:29839260-29839282 TGCCAAGGGCGAGCCAGGCATGG - Intronic
1146382662 17:32342270-32342292 AGGCAAGGACTGGCCTGGAAAGG + Intronic
1151426452 17:74033864-74033886 TGCCAAAGACAGACCCGGGAAGG - Intergenic
1151582398 17:74987842-74987864 TGCCAGGGTCCGGCCCGGCCGGG - Exonic
1151873997 17:76856294-76856316 TGCCAAGGTCTGGATCGGGAAGG + Intergenic
1154199173 18:12287569-12287591 GGCCAAGGAATGCCCCTGCAGGG - Intergenic
1154491297 18:14924448-14924470 TGCCTAGCACAGGCCGGGCATGG - Intergenic
1158818832 18:61135246-61135268 TAGCAAGGATTGGCCAGGCATGG + Intergenic
1159458670 18:68694511-68694533 TGCCAAGGACGAGCGAGGCATGG - Intronic
1161625901 19:5326528-5326550 TGTCAAGTACTGGCTGGGCACGG + Intronic
1161780348 19:6287514-6287536 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1162126901 19:8504342-8504364 TGCCGAGGACTGGCCAGATAAGG + Intergenic
1162717888 19:12645258-12645280 TGACAAGGACTGGCCCAGGGTGG - Intronic
1162822330 19:13230512-13230534 AGACAAAGACTGGCCGGGCACGG + Intronic
1163209502 19:15830102-15830124 TGCCAAGGAGTGGCCTGGGGAGG - Intergenic
1164821392 19:31254095-31254117 TGCCCAGGACCTGCCTGGCAAGG - Intergenic
1166693062 19:44835727-44835749 TGCCAGGGGCTGGCCAGGCATGG - Intergenic
1166954152 19:46451443-46451465 TGCCCAGGCCTGGATCGGCAGGG - Intergenic
1167472277 19:49682035-49682057 TGCCAAGGCCGGGGCCCGCAAGG + Exonic
1167538494 19:50070725-50070747 TGCCCTGGACTGGCCTGGCCTGG + Intergenic
1202715145 1_KI270714v1_random:38232-38254 TGCCAAGTACGGGCCAGGCTGGG + Intergenic
926129712 2:10295124-10295146 TGCCAAGGACGTGCCCTGCAAGG - Intergenic
928311547 2:30214669-30214691 TGTAAAGTACTGGCCGGGCACGG - Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
932228315 2:70061103-70061125 GGCAAAGGACAGGCCGGGCACGG + Intergenic
932611036 2:73200422-73200444 TACCAAGGGCTGGCTGGGCACGG - Intergenic
932748270 2:74353359-74353381 TCCCAAGTACTGGCCAGGCGCGG - Intronic
932945791 2:76228992-76229014 TACAAAGGATTGGCCAGGCACGG + Intergenic
935071189 2:99695271-99695293 TACGAAGGACTGGCCCAGCCAGG - Intronic
935255187 2:101303874-101303896 TGCCAAGTACTGGCAAGGCTTGG - Intronic
935638721 2:105270669-105270691 AGCCAAGGGCTGGCCCTGCAAGG + Intronic
936017707 2:108972294-108972316 TGTCGAGAACTGGGCCGGCATGG - Intronic
936171903 2:110184292-110184314 TGTCAAGGACTGGAACGACATGG + Intronic
938096313 2:128466502-128466524 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
938372498 2:130780880-130780902 TACCTAAGACTGGCCGGGCACGG + Intergenic
938721974 2:134075443-134075465 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
940722595 2:157298424-157298446 TGCCTTGGACTGGCCAAGCAGGG + Intronic
940791433 2:158033600-158033622 TGCCAAGGAATTGCCCTACATGG - Intronic
944739918 2:202601846-202601868 TTACAAAGACTGGCCAGGCATGG - Intergenic
945041674 2:205747890-205747912 TTCCAAGGAATGGCCAGGCAGGG - Intronic
947417863 2:229917088-229917110 TACCAAGCACTGGCCGGGCGCGG + Intronic
947418780 2:229922800-229922822 TGCCAGGGACTAGCCGGGCTCGG - Intronic
947635866 2:231680632-231680654 TGCCAAGCGGGGGCCCGGCAGGG - Intergenic
948713309 2:239839469-239839491 TGCCAAGGGCGAGCCAGGCATGG - Intergenic
948906670 2:240982928-240982950 AGCCAAGGTCTGGCCAAGCAGGG + Intronic
1168799147 20:633487-633509 TCCCAAGGCCTGGCCCAGCAGGG - Intergenic
1169880632 20:10342407-10342429 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1170458507 20:16554973-16554995 TGCCAAGGGCAAGCCAGGCATGG - Intronic
1171401226 20:24873994-24874016 AGCCAAGGACTGCCCAGACAGGG + Intergenic
1171424892 20:25043073-25043095 TGCCAGGGACAGGGCAGGCAGGG + Intronic
1172332766 20:34087181-34087203 TGCACAGCACTGGCCAGGCACGG + Intronic
1172960798 20:38798065-38798087 TGCAAAGGACAGGCCCAGGAAGG + Intergenic
1172993836 20:39055419-39055441 TCCCAGCGACTGGCCAGGCACGG + Intergenic
1173899680 20:46578218-46578240 AGCCAAGGACTGACCGGGCGTGG - Intronic
1174254317 20:49243008-49243030 TACCAAGGGCTCGCCGGGCACGG - Intronic
1174318641 20:49722706-49722728 TATCAAGTACTGGCCGGGCATGG + Intergenic
1175350932 20:58317385-58317407 TGCCCAGGGTTGGCCAGGCACGG - Intronic
1176424575 21:6540250-6540272 GGCCAAGGTCTGGCTGGGCAAGG + Intergenic
1179700068 21:43148565-43148587 GGCCAAGGTCTGGCTGGGCAAGG + Intergenic
1180068536 21:45424723-45424745 GGCCAAGGGCTGCCCCGGAAGGG - Intronic
1181776493 22:25163726-25163748 AGCCAAGGAATGGCCGGGCGTGG - Intronic
1182176485 22:28294855-28294877 TGTCAAGAGCTGGCCAGGCACGG - Intronic
1184717798 22:46291662-46291684 TGCCACAGACAGGCCGGGCACGG + Intronic
949302369 3:2599194-2599216 TGCCAAGGAGTGGCCCAGGAGGG - Intronic
949918583 3:8984256-8984278 TGCCAAGGACTGCCCCTCCCTGG + Exonic
950398502 3:12752506-12752528 TGCCCAGGACCGGCCGGGCGCGG + Intronic
950903303 3:16515824-16515846 TGCTATGGACTGGCCAGCCATGG + Intergenic
952536989 3:34321611-34321633 TACTAAGGATTGGCCCGGCATGG - Intergenic
953879852 3:46685995-46686017 TGGCATGGACTGCCCCTGCAGGG - Intronic
954248701 3:49352051-49352073 TAGAAAGGACTGGCCGGGCATGG + Intergenic
954320442 3:49829034-49829056 GGTCAAGGACTGTCCAGGCAGGG - Exonic
954451988 3:50576697-50576719 TGCTAAGAACTGGCTGGGCACGG - Intronic
954558238 3:51535098-51535120 TACCAGGCACTGGCCAGGCACGG - Intergenic
955111758 3:55957633-55957655 TGCCAAGGGCAAGCCAGGCATGG + Intronic
956197717 3:66669902-66669924 TGACAAGTACAGGCCGGGCACGG - Intergenic
957307893 3:78481273-78481295 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
958677960 3:97291963-97291985 TGCCAAGGGCAAGCCAGGCACGG + Intronic
959320372 3:104866480-104866502 TGGCAAGGGCAGGCCTGGCATGG - Intergenic
959340148 3:105118524-105118546 TGGGAAGGGCTGGCCAGGCACGG - Intergenic
959492529 3:107007700-107007722 TGCCTAAGTCTGGCCAGGCATGG + Intergenic
961942849 3:130655890-130655912 TGCCAAGGGCAAGCCAGGCATGG + Intronic
962210378 3:133472374-133472396 TGCCAAGCACTGGCATGACATGG + Exonic
963233497 3:142933482-142933504 TGTGAAGGACTGGCTTGGCAGGG - Intergenic
963353419 3:144180455-144180477 TGCAAAGGCATGGCCTGGCACGG + Intergenic
966014840 3:175129475-175129497 TGCCAAGGACTGGACAGGGGTGG - Intronic
967094797 3:186168554-186168576 TACCAAGTGCTGGCCAGGCATGG + Intronic
967382318 3:188872777-188872799 TGCCACAGACTGGCAGGGCAGGG - Intronic
967953996 3:194863134-194863156 TGGCATGGACTGGCCGAGCAAGG - Intergenic
968142822 3:196272980-196273002 TGCCAAGGACAAGCCAGGCACGG + Intronic
968472177 4:787186-787208 TGCCAGGGAGTGGCCCTGCTGGG - Intronic
971092541 4:23361665-23361687 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
971368018 4:25993164-25993186 TTCCAAGAATTGGCCAGGCACGG - Intergenic
972251693 4:37309084-37309106 GGCCCAGGACTGGCCCACCAAGG - Intronic
972907058 4:43763369-43763391 TGCCAAGGGTTGGCCATGCATGG - Intergenic
973779729 4:54277082-54277104 TCCCAGGGGCTGGCCCAGCACGG + Intronic
974683371 4:65194129-65194151 TGCCAAGGGCAAGCCAGGCAAGG + Intergenic
974957290 4:68657255-68657277 TGACATGGAGTGGCCCTGCAGGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
976576344 4:86676844-86676866 TGCCAAGGACTGGGCAGAGAGGG + Intronic
977642045 4:99368143-99368165 GGCCCAGGACTGGCCCCTCATGG - Intergenic
980054955 4:128070368-128070390 TGCTGAGGACTGCCCGGGCACGG + Intronic
980109588 4:128622440-128622462 TGCCAAGTCCAGGCCAGGCATGG + Intergenic
981727212 4:147861121-147861143 TGCCAAGGGCGAGCCAGGCACGG + Intronic
986513570 5:8535455-8535477 TGTCAAGGAATTGCCCGTCATGG + Intergenic
986725723 5:10594980-10595002 AGCCCAGGACTGGCCCTGCTGGG - Intronic
987999710 5:25331908-25331930 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
990068342 5:51747076-51747098 TTCAAAGGAGGGGCCCGGCATGG - Intergenic
993059621 5:83023404-83023426 TCACAAGAACTGGCCGGGCAAGG - Intergenic
995524581 5:113040260-113040282 TGACAAGGGCTGGCCAGGTAAGG + Intronic
997648642 5:135498592-135498614 TGCCAAGGCCTGGCTCTGCATGG - Intergenic
999690503 5:154142076-154142098 TGCCAAGAACTGGCCTGTCAGGG - Intronic
999988397 5:157026429-157026451 TGCTAAGCCCTGGCCAGGCACGG + Intergenic
1001455590 5:171857676-171857698 TCCCAAGGACAAGCCAGGCAAGG + Intergenic
1001743264 5:174070873-174070895 TTCCCAGCACTGGCCTGGCATGG + Intronic
1002386404 5:178870430-178870452 TGCCAAAAATTAGCCCGGCATGG - Intronic
1002719195 5:181247394-181247416 TCCCAAGGAGAGGCCGGGCACGG + Intronic
1004059319 6:12176520-12176542 TACCCAAGACTGGCCGGGCACGG - Intergenic
1004227823 6:13803349-13803371 TACCAAGTACTGGCCAGGCGTGG - Intronic
1006399046 6:33805349-33805371 ACCCAAGGACTGGCTAGGCAGGG - Intergenic
1007519979 6:42444542-42444564 TGCTAAGGAGTGGGCAGGCAGGG - Intronic
1007790898 6:44307508-44307530 AGCCCAGGACTGGACTGGCAAGG - Exonic
1008834786 6:55812526-55812548 TGCCTAGGACTGGCTGGGTAAGG - Intronic
1009870735 6:69450028-69450050 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1011837829 6:91456086-91456108 GGCCAAGGACTGGCCAAGGATGG + Intergenic
1012307240 6:97674236-97674258 TACCAAAGATTGGCCAGGCATGG + Intergenic
1012908763 6:105096303-105096325 TGCCAAGGACTTGCCACTCAAGG + Intergenic
1014936699 6:127394145-127394167 TGCCAAAAATTGGCCAGGCATGG - Intergenic
1015997471 6:139009235-139009257 TTCCAAGGCCTGGGCAGGCAAGG + Intergenic
1016403494 6:143705584-143705606 TTTCAAGGTCTGGCCAGGCACGG - Intronic
1017706402 6:157127364-157127386 TGACAAGAACTGGCCGGGCATGG + Intronic
1018190558 6:161306091-161306113 TGCCCAGGACTGGCTGTGCAGGG + Intergenic
1018190668 6:161306786-161306808 GGCCAAGGAATGGCCAGGCATGG + Intergenic
1018659848 6:166076111-166076133 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1018961156 6:168449678-168449700 TGCCAAAGAATGGCCATGCACGG - Intronic
1019533310 7:1514459-1514481 GGCAAAGAACTGGCCGGGCAGGG + Intergenic
1019541713 7:1554641-1554663 TGGCAAGGAAGGGCCAGGCAGGG - Intronic
1021768780 7:23977533-23977555 CGCCAAGTCCTGGCCAGGCACGG + Intergenic
1021999541 7:26212985-26213007 TGCTAAGGAATGGCCCGCTAGGG - Exonic
1024638202 7:51308080-51308102 TGGCAAGGACCTGCCCTGCATGG + Intronic
1025602717 7:63015036-63015058 TGCCAAGTTCAGGCCAGGCACGG + Intergenic
1026099145 7:67370353-67370375 GAACAAGGACTGGCCGGGCATGG + Intergenic
1027257327 7:76439413-76439435 AGCCCAGGACTGGCCAGGCACGG + Intronic
1027281520 7:76612628-76612650 AGCCCAGGACTGGCCAGGCACGG - Intronic
1028234507 7:88344390-88344412 TGCGAAGAATTGGCCAGGCATGG - Intergenic
1029165039 7:98582497-98582519 TGCAAATGACCGGCCAGGCATGG + Intergenic
1029715396 7:102322624-102322646 TGCCCAAGACTGGCCTTGCAGGG + Intergenic
1030221138 7:107099922-107099944 GGCACAGGACTGGCCGGGCACGG - Intronic
1034619752 7:152447601-152447623 GGTCAAGAACTGGCCGGGCACGG - Intergenic
1035117098 7:156533694-156533716 TCCCCAGGGCTGGCCTGGCATGG - Intergenic
1037065815 8:14575748-14575770 TGCAAAAAACTGGCCTGGCATGG + Intronic
1037317038 8:17608926-17608948 AGCCAAGGAGGGGCCAGGCAAGG + Intronic
1039042617 8:33422677-33422699 TGCTAAAGACTGGCTTGGCATGG + Intronic
1039110663 8:34037923-34037945 TGCCAAAAGCTGGCCAGGCATGG - Intergenic
1039912553 8:41836461-41836483 TGTCAAGGAAGGGCCCAGCACGG - Intronic
1040798776 8:51318011-51318033 TGACAATTACTGGCCGGGCACGG - Intergenic
1041956069 8:63559081-63559103 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1045782773 8:105886916-105886938 TGCCAAGGACGAGCCAGGCACGG - Intergenic
1048872990 8:138814107-138814129 TGCCAGGGCCTGGCCCTGCCTGG + Intronic
1049844845 8:144795108-144795130 TGCCTAGCATTGGCCAGGCACGG - Intergenic
1054201709 9:62090079-62090101 AGCAAAGGACTGGCCGGGCGTGG + Intergenic
1054636650 9:67498280-67498302 AGCAAAGGACTGGCCGGGCGTGG - Intergenic
1055060280 9:72061560-72061582 TGCCATCCACTGGCCAGGCACGG + Intronic
1055311890 9:74991428-74991450 TACCAAGGTTTGGCCGGGCATGG - Intronic
1057238044 9:93381553-93381575 AGGCAAGGACAGGCCAGGCATGG + Intergenic
1059201267 9:112419292-112419314 TGTCAAGGACAGGCCGGGCGTGG - Intronic
1059302717 9:113328019-113328041 GCCGAAGGACTGGCCAGGCATGG - Intronic
1061201426 9:129140615-129140637 TGCCAGGGGCCTGCCCGGCAAGG - Intronic
1061289468 9:129642369-129642391 TGCCAGGGCCCGGCCCGGCTCGG + Intergenic
1061987395 9:134137390-134137412 TGCCAAGCCTTGGCCCGGCGCGG + Intronic
1062147644 9:134998836-134998858 TGCCAAGGAGTGGCCCTGACTGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1185468082 X:367551-367573 TGTCAATGGCTGGCCGGGCACGG - Intronic
1186991957 X:15079764-15079786 TGCCAACCAGTGGCCCTGCATGG + Intergenic
1188020305 X:25149802-25149824 TGCCAAGAACAGGCCGGGCGCGG - Intergenic
1188195065 X:27222906-27222928 TGCCAAGGGCGGGCCAGGTATGG - Intergenic
1189745199 X:44161618-44161640 TGCCAAGGACTGGCCTGGGCAGG + Intronic
1189960002 X:46315290-46315312 GGCCAAGGATTGGACTGGCAGGG - Intergenic
1190040806 X:47070501-47070523 TGCAAAGAACTGGCCAGGCATGG + Intergenic
1190341729 X:49302170-49302192 TGGCAACAACAGGCCCGGCACGG - Intergenic
1190343923 X:49320551-49320573 TGGCAACGACGGGCCCGCCACGG - Intergenic
1190345018 X:49330095-49330117 TGGCAACGACGGGCCCGCCACGG - Intergenic
1190346112 X:49339660-49339682 TGGCAACGACGGGCCCGCCACGG - Intergenic
1190347367 X:49530691-49530713 TGCCAACGACGGGCCCGCCACGG - Intergenic
1190348466 X:49540247-49540269 TGCCAACGACGGGCCCGCCACGG - Intergenic
1190349567 X:49549803-49549825 TGCCAACGACGGGCCCGCCACGG - Intergenic
1190350670 X:49559356-49559378 TGGCAACGACGGGCCCGCCACGG - Intronic
1190351772 X:49568914-49568936 TGGCAATGACGGGCCCGCCACGG - Intergenic
1190352873 X:49578463-49578485 TGCCAACGACGGGCCCGCCACGG - Intergenic
1190353974 X:49588010-49588032 TGCCAACGACGGGCCCGCCACGG - Intergenic
1190355075 X:49597534-49597556 TGGCAACGACGGGCCCGCCACGG - Intronic
1190360443 X:49644189-49644211 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1190950893 X:55141486-55141508 TACCCAAGACTGGCCGGGCACGG - Intronic
1193386034 X:80872439-80872461 TTCAAAGGACTGGCCGGGCGCGG - Intergenic
1196851362 X:119942175-119942197 TGAAAAGGACAGGCTCGGCAGGG + Intronic
1201579926 Y:15500498-15500520 TGCTAAGGATTGACCTGGCATGG - Intergenic