ID: 922461416

View in Genome Browser
Species Human (GRCh38)
Location 1:225816917-225816939
Sequence GGGAATTCCCTCCCACACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922461409_922461416 29 Left 922461409 1:225816865-225816887 CCAAATTGTTTTCTTTCTATCTC 0: 1
1: 1
2: 9
3: 144
4: 1276
Right 922461416 1:225816917-225816939 GGGAATTCCCTCCCACACAGAGG 0: 1
1: 0
2: 2
3: 7
4: 150
922461408_922461416 30 Left 922461408 1:225816864-225816886 CCCAAATTGTTTTCTTTCTATCT 0: 1
1: 1
2: 16
3: 133
4: 1401
Right 922461416 1:225816917-225816939 GGGAATTCCCTCCCACACAGAGG 0: 1
1: 0
2: 2
3: 7
4: 150
922461411_922461416 5 Left 922461411 1:225816889-225816911 CCAGACATGTAGATAGCATGGAG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 922461416 1:225816917-225816939 GGGAATTCCCTCCCACACAGAGG 0: 1
1: 0
2: 2
3: 7
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922461416 Original CRISPR GGGAATTCCCTCCCACACAG AGG Intronic
900972033 1:5997086-5997108 GGGGCTTCCCTGGCACACAGTGG + Intronic
903624735 1:24722331-24722353 TGGAGTTCCCTTCCACACTGTGG + Intergenic
904615704 1:31748397-31748419 AGCAATTCATTCCCACACAGGGG + Intronic
905231822 1:36519169-36519191 GGGAACTCCCTCCCAGACTTCGG + Intergenic
911064986 1:93780045-93780067 TGGAATTCCCTCCCACCCTCAGG + Intronic
912274203 1:108239575-108239597 GGGACTTCCTGCACACACAGAGG - Intronic
912287064 1:108380287-108380309 GGGACTTCCTGCACACACAGAGG + Intronic
912294016 1:108454748-108454770 GGGACTTCCTGCACACACAGAGG + Intronic
913583320 1:120248903-120248925 GGGCCTGCCTTCCCACACAGCGG - Intergenic
913624852 1:120649419-120649441 GGGCCTGCCTTCCCACACAGCGG + Intergenic
914565308 1:148860739-148860761 GGGCCTGCCTTCCCACACAGCGG - Intronic
914607517 1:149269509-149269531 GGGCCTGCCTTCCCACACAGCGG + Intergenic
918473394 1:184898175-184898197 GTGAAGACCCTGCCACACAGAGG - Intronic
919371099 1:196726930-196726952 GGGTATTCTCACCCACACACTGG - Exonic
919834678 1:201565618-201565640 GGCAATTCTTTCCCACAGAGGGG - Intergenic
922461416 1:225816917-225816939 GGGAATTCCCTCCCACACAGAGG + Intronic
924114759 1:240734277-240734299 AAGAATTCCCTCTCACTCAGGGG - Intergenic
1066095565 10:32068881-32068903 GGGAATTCCCTTCTACAGAAGGG - Intergenic
1067199573 10:44155701-44155723 TGGAAGTCCCTCCAGCACAGTGG + Intergenic
1071766849 10:88676488-88676510 GGGAAGTCTCTCACACACAGGGG - Intronic
1073228155 10:101942498-101942520 TGGAAGTCCTTCCCATACAGTGG + Intronic
1076782992 10:132734743-132734765 GGGAAATCACTCCCAGGCAGGGG - Intronic
1080410879 11:32023756-32023778 AGGAATTCACACCCACACTGAGG + Intronic
1081127380 11:39338263-39338285 TGGAATTCCTTCCCATAAAGAGG - Intergenic
1084033812 11:66495871-66495893 GTGACTTGCCTCCCAAACAGTGG - Intronic
1084183662 11:67458930-67458952 GGGAACTCCCTACCTCCCAGAGG - Exonic
1084266648 11:68008577-68008599 GGGGGCTCCATCCCACACAGAGG + Intronic
1084375235 11:68772422-68772444 GAGCATTCCATCCCAGACAGGGG - Intronic
1084550184 11:69836403-69836425 GGTGATTCTCTCCCACACAACGG + Intergenic
1085760442 11:79236848-79236870 GGATCTTCCCACCCACACAGTGG + Intronic
1089125786 11:116175613-116175635 GATTATTCCCTCCCACAGAGTGG + Intergenic
1090301677 11:125646889-125646911 GGGAATTTTCTCCCACAGAATGG - Intronic
1090406269 11:126477359-126477381 GGGGGCTCCCTCCCACACACAGG - Intronic
1090920976 11:131205540-131205562 GGGCAATTCCTCCCCCACAGGGG - Intergenic
1102787511 12:115616720-115616742 GGGAAATGCCTTCCAGACAGAGG - Intergenic
1103926773 12:124427633-124427655 GGGGATTCTCTCCCACCCCGGGG - Intronic
1104267188 12:127244533-127244555 GGGAATGCCCCACCACACATGGG + Intergenic
1104888288 12:132124937-132124959 GGCAGCTCCCTCCCACACATAGG - Intronic
1105951031 13:25229699-25229721 GGGGATTCCCTCACACAGGGAGG - Intergenic
1107765504 13:43730077-43730099 GGGCATTCCCTCTCACCCATGGG + Intronic
1113887668 13:113669465-113669487 GTGAATTCCTTCACATACAGGGG - Intronic
1114664788 14:24371011-24371033 GGGAATTTCCTGCAACAGAGTGG - Intronic
1116170142 14:41390459-41390481 TGGAATTCTTTCCCACACAGTGG + Intergenic
1116931843 14:50698495-50698517 GGGAATGCCATCCCAGACATAGG - Intergenic
1119603692 14:75995949-75995971 TGACATTCCCTCCCACACAGCGG - Intronic
1120685577 14:87532721-87532743 TGGAATTCCCCACCTCACAGTGG + Intergenic
1121406013 14:93719838-93719860 GGGCATACCCTCCCATAAAGGGG - Exonic
1124712798 15:32029872-32029894 GGGAATCCCATCACACACATTGG + Intergenic
1129826931 15:78640570-78640592 AGAAGTCCCCTCCCACACAGCGG - Intronic
1129887464 15:79048699-79048721 GAGATTTTCATCCCACACAGTGG - Intronic
1131897343 15:97048104-97048126 GGGAATGCCTTTCCACACTGTGG + Intergenic
1132149126 15:99447307-99447329 GGGGATTCCCTACCATGCAGGGG + Intergenic
1132332771 15:101024349-101024371 GGAAACTCCCTCCCACCCTGTGG - Intronic
1133063214 16:3188671-3188693 GCGAATTCCCTCGCTCTCAGTGG - Intergenic
1136086661 16:27890221-27890243 GGCCATTCCATCCCACTCAGCGG - Intronic
1138389397 16:56659006-56659028 GGGACCTCCCTCCCCAACAGAGG - Intronic
1139485244 16:67252483-67252505 TGGAATATCCTCCCACACACAGG - Intronic
1141528656 16:84630127-84630149 GGGAACTCACTACCTCACAGAGG - Intergenic
1142987409 17:3704540-3704562 CGGAAGTGCCTCCCACAGAGAGG - Intergenic
1143040894 17:4035675-4035697 GGGAGTTCACCCTCACACAGGGG + Intronic
1148330676 17:46812198-46812220 GGGAATTCCCTCTCTGGCAGCGG + Intronic
1152366195 17:79857919-79857941 GGGAATTCGCTCACACACTATGG + Intergenic
1152409414 17:80115189-80115211 GGGACTTCCGTTCCACACATTGG + Intergenic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152610475 17:81312869-81312891 CGGGGTTCCGTCCCACACAGTGG - Exonic
1154443598 18:14414662-14414684 GGCACCTCCCTCCCACACAATGG - Intergenic
1156461345 18:37323011-37323033 GCCAATTCCCTCCCGTACAGCGG + Intronic
1157834877 18:50891642-50891664 AAGAATTCACTCCCACAAAGAGG + Intronic
1163609399 19:18293050-18293072 CGGAATTTCCTCCCCCCCAGGGG + Intergenic
1164403158 19:27916909-27916931 TGGAAATCTTTCCCACACAGGGG - Intergenic
1164783453 19:30911761-30911783 GGGAATTTGCACCCAGACAGGGG + Intergenic
1168404350 19:56103053-56103075 GGGGGTTTCCTCCCACCCAGAGG + Intronic
927214613 2:20661155-20661177 GGGAAATGCCTCCAAGACAGTGG + Intergenic
927576616 2:24206702-24206724 GGCAACTCCCTCCCACATCGGGG - Intronic
928405854 2:31014382-31014404 GAGAAGCCCCTCCCACAGAGAGG + Intronic
930724101 2:54665990-54666012 TGGAATTCCCTACCACAGCGAGG + Exonic
931693246 2:64852982-64853004 GGGCATTTCCTCCCACAGACTGG + Intergenic
931871051 2:66459974-66459996 GATAATTCCCTCCTCCACAGTGG - Intronic
934847268 2:97669899-97669921 GGGCGTTCCCTCCCACAGTGTGG + Intergenic
935691269 2:105734414-105734436 GGATATTCCCTCCCAGACACTGG - Intergenic
936376359 2:111944526-111944548 AGGAATTAGCTCACACACAGTGG + Intronic
936784501 2:116077777-116077799 AGGAATTCCCTCTTACTCAGTGG + Intergenic
939171560 2:138702009-138702031 GAGAATTCTCTGCAACACAGAGG + Intronic
941127191 2:161598432-161598454 GGGAATACCCTTCCCCACATTGG + Intronic
942285546 2:174412485-174412507 GGGAATTCTCTCCCATCTAGAGG + Intronic
943065688 2:183083830-183083852 GGAAAGTCTATCCCACACAGAGG - Intronic
1173902968 20:46604561-46604583 GGGAAGTCCCTTCCACACCACGG + Intronic
1174612804 20:51813008-51813030 GGGAATTGCATTCCAGACAGAGG + Intergenic
1175780224 20:61677385-61677407 GGGAAGGCCCTCCCACAGAAGGG - Intronic
1176452491 21:6876576-6876598 GGCACCTCCCTCCCACACAATGG + Intergenic
1176830664 21:13741625-13741647 GGCACCTCCCTCCCACACAATGG + Intergenic
1180699497 22:17773945-17773967 CGGAATCCCCGCCCACACCGTGG - Exonic
1181887268 22:26031271-26031293 GGGAATTCCCTCCCACGGGTGGG - Intergenic
1182413841 22:30208464-30208486 GAGAATTCCCTCTGACACAAGGG + Intergenic
1182435041 22:30325237-30325259 GGGAGTTCCCTCTCACCCACTGG - Intronic
1182947932 22:34342558-34342580 GGGAATTCCCTCCTACTCAAGGG - Intergenic
950047970 3:9962129-9962151 TGGAATGCCCTTCTACACAGAGG + Intergenic
950116942 3:10456998-10457020 GGAAATTGCCTCCCCCAGAGAGG - Intronic
952311508 3:32194708-32194730 AGGAATGCCCACACACACAGAGG + Intergenic
954376291 3:50195695-50195717 GGAATATCCCTCCCACACACAGG + Exonic
954911440 3:54114125-54114147 GGGAAGTTCTCCCCACACAGGGG + Intergenic
957616325 3:82532604-82532626 GGGAATTACTTACCACAGAGTGG + Intergenic
961939034 3:130618155-130618177 GGGAATCCTGTCCCACACAAGGG + Intronic
965801225 3:172496342-172496364 GGGAAGTCTCTCCCAGTCAGGGG + Intergenic
966566280 3:181385080-181385102 TGCAGTTCCCTCCCACACTGAGG + Intergenic
970601514 4:17644010-17644032 GGGCCTTCCCTGGCACACAGTGG - Intronic
975139013 4:70901995-70902017 GGTAATTCCATCCCTCACTGCGG + Intergenic
975583887 4:75931096-75931118 TGGAAGTCCCTGCCACATAGTGG + Intronic
975847643 4:78541773-78541795 GAGAACTCCCTCCTACAAAGGGG + Intronic
976339513 4:83931456-83931478 TGGAACTCCATGCCACACAGAGG - Intergenic
978429647 4:108620394-108620416 GTGAATCCCCGCCCACAGAGGGG + Intergenic
980736112 4:136890937-136890959 GGGAAAGCCCTCTCAAACAGTGG - Intergenic
985623406 5:968675-968697 GCAAAGTCCCTTCCACACAGTGG + Intergenic
985651328 5:1109103-1109125 TGGAAGTCCCTCCTAGACAGTGG + Intronic
987848621 5:23320105-23320127 GGGAAGTTGCTCCCACTCAGTGG - Intergenic
988717886 5:33845944-33845966 GGGAACTCACTCCCACAAAATGG + Intronic
990825192 5:59892075-59892097 GTGAATCCCCTCCCCCACACAGG - Intronic
992249769 5:74865878-74865900 GGGCATTCCCTCACACAAAATGG + Intronic
992730571 5:79663562-79663584 GGGAATTGCCTGCCAGTCAGTGG + Intronic
993133516 5:83928314-83928336 TGGAATTCTCTCCCACAAACTGG - Intergenic
995737497 5:115317478-115317500 GGGCTAGCCCTCCCACACAGGGG + Intergenic
1000122338 5:158209184-158209206 GGGGATTCACTCCCAAATAGTGG - Intergenic
1002082236 5:176743975-176743997 TGGAATTCAGTCCCACACAAGGG - Intergenic
1003023404 6:2531315-2531337 GAGAATGCCCACCCACACTGGGG + Intergenic
1005224979 6:23632196-23632218 GGGAGTGCCCACCCCCACAGAGG - Intergenic
1006109906 6:31738254-31738276 GGGAATTCACACCCACACAGAGG - Intronic
1006117346 6:31782251-31782273 GGCAAGCCCCTCCCACACTGAGG + Intronic
1006215359 6:32437463-32437485 GGAAATTCCCTCAAACACACAGG + Intergenic
1007549859 6:42720892-42720914 GGCTGTTCCCTCCGACACAGTGG + Intronic
1007981782 6:46166682-46166704 GAGAATTCCATCCCTCAGAGGGG - Intronic
1010180272 6:73078640-73078662 CTGACTTCCCTCCCACACTGTGG - Intronic
1013550976 6:111207746-111207768 GGGAAACACCTCCCACACTGTGG + Intronic
1017032191 6:150234034-150234056 GCGAATTCCCACGCAGACAGTGG + Intronic
1018186082 6:161266037-161266059 GGGAATTCCCCCTCAAGCAGTGG + Intronic
1019424732 7:969157-969179 GGGAACGCCGTCCCACTCAGGGG + Exonic
1019716706 7:2542539-2542561 GGCAGGTCCCTCCCACAGAGTGG - Intronic
1023331227 7:39119141-39119163 GGGAATTCCCAGCCACACAGGGG + Intronic
1023998683 7:45177362-45177384 GCGAAAGCCTTCCCACACAGGGG - Exonic
1034606118 7:152317657-152317679 GGGAATTCTAACCCACACAAAGG + Intronic
1035571812 8:677333-677355 GGGAACTCTCTTCCACAAAGCGG - Intronic
1038718372 8:30011856-30011878 GGGAAGTCACTCCCACTCATTGG - Intergenic
1039791245 8:40877363-40877385 GGGACTTCACAGCCACACAGAGG - Intronic
1040763706 8:50880871-50880893 GAAAATTCCCTCCCCCACATGGG + Intergenic
1042753271 8:72181745-72181767 AGGAATTCCCTCTTACTCAGGGG - Intergenic
1042795391 8:72656949-72656971 GGGACTTCCATCCCACATATGGG - Intronic
1049282429 8:141756967-141756989 GGGAGTTTCCTCCCAAAGAGGGG - Intergenic
1051366891 9:16327575-16327597 GGGAATTCCCACCCACACCAGGG - Intergenic
1056100652 9:83297851-83297873 GGCATTTCTCTCCCACACCGGGG - Intronic
1060741360 9:126099656-126099678 GAGAAATGCCTCCCACACAGTGG + Intergenic
1062275683 9:135729384-135729406 CGGAATCCCCTCCTGCACAGTGG - Intronic
1203516690 Un_GL000213v1:7939-7961 GGCACCTCCCTCCCACACAATGG - Intergenic
1203376933 Un_KI270442v1:384080-384102 GGAAAGTCCCATCCACACAGGGG - Intergenic
1186352648 X:8756166-8756188 GGGAATGACCTTCCCCACAGAGG - Intergenic
1187483860 X:19683649-19683671 GGGAAGTCGTTCCCACACAGAGG + Intronic
1190301144 X:49058369-49058391 GGCAATTCCCACCCTCACTGGGG - Intronic
1190596046 X:52053422-52053444 GGGCCTTCCCACCCAAACAGGGG - Intronic
1190612778 X:52200651-52200673 GGGCCTTCCCACCCAAACAGGGG + Intronic
1197865178 X:131009774-131009796 GAGAATTCTCTCCCACTCACTGG - Intergenic
1200009572 X:153110992-153111014 TGGATATTCCTCCCACACAGTGG - Intergenic
1200030028 X:153288930-153288952 TGGATATTCCTCCCACACAGTGG + Intergenic