ID: 922462941

View in Genome Browser
Species Human (GRCh38)
Location 1:225826979-225827001
Sequence CCTACAGAACTGCAGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922462937_922462941 3 Left 922462937 1:225826953-225826975 CCAAGCTGATTTTCCTGATTAGA 0: 1
1: 0
2: 0
3: 9
4: 248
Right 922462941 1:225826979-225827001 CCTACAGAACTGCAGGAATAAGG 0: 1
1: 0
2: 2
3: 12
4: 143
922462938_922462941 -10 Left 922462938 1:225826966-225826988 CCTGATTAGATTTCCTACAGAAC 0: 1
1: 0
2: 1
3: 14
4: 95
Right 922462941 1:225826979-225827001 CCTACAGAACTGCAGGAATAAGG 0: 1
1: 0
2: 2
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922462941 Original CRISPR CCTACAGAACTGCAGGAATA AGG Intronic
900476139 1:2877259-2877281 CCAAAAATACTGCAGGAATAGGG - Intergenic
900762207 1:4480835-4480857 CCTACAGACCTGGAAGAAAATGG + Intergenic
900774321 1:4570686-4570708 CCTGCTCATCTGCAGGAATATGG - Intergenic
902375867 1:16029717-16029739 CATCCAGAACTGCAGGAAGGGGG - Exonic
902447565 1:16476693-16476715 CATCCAGAACAGCAGGGATACGG + Intergenic
902467463 1:16626908-16626930 CATCCAGAACAGCAGGGATACGG + Intergenic
904990373 1:34587936-34587958 CCTACAGTACTGCTGGATGAGGG - Intergenic
906824173 1:48961152-48961174 CCTAGAACACTGCAGGAACATGG + Intronic
908444365 1:64187587-64187609 CCAACTGAGCTGCAGGAATTAGG + Intergenic
910630745 1:89351391-89351413 AGCACAGAAATGCAGGAATATGG + Intergenic
910927671 1:92413128-92413150 CACACTGGACTGCAGGAATATGG - Intergenic
914743358 1:150483339-150483361 TCCACAGAAGTGCAGGAAAAAGG - Intergenic
916397998 1:164412844-164412866 CCAGCAGAACTGTAGGAATGGGG + Intergenic
917104654 1:171480293-171480315 CTCACAGAGCTGCAGGAAGAAGG - Intergenic
918589334 1:186222950-186222972 CTTACAGAATTGGAGAAATAAGG + Intergenic
922462941 1:225826979-225827001 CCTACAGAACTGCAGGAATAAGG + Intronic
923338334 1:232988291-232988313 CCTAGAGAATTCCAGGAACAAGG + Intronic
924081415 1:240401958-240401980 CCTCCAGGGCTGTAGGAATATGG + Intronic
1063922715 10:10948186-10948208 AATACAGAACTGGAGGACTATGG - Intergenic
1067495597 10:46757478-46757500 CCTGCAGGACTGCAGGACTGCGG + Intergenic
1067599056 10:47582910-47582932 CCTGCAGGACTGCAGGACTGCGG - Intergenic
1067744774 10:48927423-48927445 CCCACAGAAGTGCTGGAATAAGG - Intronic
1067948719 10:50709495-50709517 CCTGCAGGACTGCAGGACTGCGG - Intergenic
1069604897 10:69732804-69732826 CCCACAGAAAGGCAGGACTAGGG + Intergenic
1070377655 10:75849294-75849316 CCTACAGAACTGCATCAGTTAGG - Intronic
1072027578 10:91476758-91476780 CCCACAGAACTTCAAGAAGACGG - Intronic
1073439302 10:103543327-103543349 CCAATAGTACTGCAGGAACAAGG + Intronic
1077826786 11:5819176-5819198 ACTACAGAACTTAAGGATTAGGG + Intronic
1078731297 11:13976578-13976600 CCTACAGGAATGCAGTATTATGG + Intronic
1081652744 11:44835200-44835222 CCGACAGCACTGCTGGAGTATGG + Intronic
1081660746 11:44886702-44886724 CCTAAAGATCTGTAAGAATAAGG + Intronic
1088446290 11:109932392-109932414 CCTACAGAACTTCTGGTAGATGG + Intergenic
1090117723 11:123992553-123992575 CCTACAGAACTGCAGTGCAATGG - Intergenic
1091104819 11:132908867-132908889 CCTTCAGACCTGCAGGATTGAGG + Intronic
1095462496 12:42457311-42457333 CCTGAAGAAATGCAGGTATAAGG - Exonic
1095751855 12:45721403-45721425 CCTACTGAACTGAAGGGAAAGGG - Intergenic
1098762569 12:74443481-74443503 CCTGCAAAACTGCAGGAAGCTGG + Intergenic
1098914935 12:76247529-76247551 CCCACAGAACAGCATGAAGAAGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100846066 12:98659425-98659447 CCTATAGAACAGCAGGAAAAAGG - Intronic
1104369397 12:128209941-128209963 GCTACAGATGTGAAGGAATATGG - Intergenic
1104933341 12:132351920-132351942 CCTGCAGAGCTGCAGGAACGGGG - Intergenic
1106838003 13:33656883-33656905 TCTAGAGAACTGCAGGATTCAGG - Intergenic
1109635540 13:65110177-65110199 CCTATAAAGCTGCAGTAATAGGG - Intergenic
1111234164 13:85386834-85386856 TCTAAAGAGCTGCAGTAATAAGG - Intergenic
1113522789 13:110952654-110952676 ACCACAGACCTCCAGGAATAAGG + Intergenic
1113702581 13:112398183-112398205 ACCACAGACCTCCAGGAATAAGG - Intronic
1114602389 14:23967197-23967219 CATCCAGAGCTGCAGGAAGAAGG - Exonic
1114612058 14:24049271-24049293 CATCCAGAGCTGCAGGAAGAAGG - Intergenic
1114751919 14:25214242-25214264 CCTTAAGCACTGCAGGAATCTGG - Intergenic
1116563128 14:46409013-46409035 CCAACAGAATTAAAGGAATAAGG + Intergenic
1117476965 14:56105326-56105348 CCTACTGAACTTCAAGAATAAGG + Intergenic
1120529335 14:85613299-85613321 CTTATAGTACTGCAGAAATAGGG - Intronic
1121713832 14:96058777-96058799 CCTACAGCATTGCAGCAGTAGGG + Intronic
1123679204 15:22745562-22745584 ATTCCAGAACTGCAGGAATATGG + Intergenic
1124094123 15:26632942-26632964 CCTCCAGAACTGAATGAAAAAGG + Intronic
1124331424 15:28820012-28820034 ATTCCAGAACTGCAGGAATATGG + Intergenic
1124709054 15:31990038-31990060 CCTACAGAGCTGTAGGAGCAGGG - Intergenic
1127181662 15:56426069-56426091 TCCACAGAACTGCAGGAACCTGG - Intronic
1134387290 16:13785652-13785674 TCTTCAGAACTGCAGGAACTGGG + Intergenic
1136270789 16:29147042-29147064 CCCACAGAGCTGCTGGCATATGG - Intergenic
1141673912 16:85507534-85507556 CCTCCAGAACTGCAAGGAAATGG - Intergenic
1141926844 16:87175354-87175376 CCTACAGAGCTGCAGGGACCTGG + Intronic
1142107889 16:88316007-88316029 CCTACAGAGCTGCAGGTGCATGG - Intergenic
1143049502 17:4112580-4112602 CCAACAGAACTGAGGGGATAGGG - Intronic
1144378393 17:14668385-14668407 CCTATAGAACTACAGAATTAGGG - Intergenic
1148322630 17:46766778-46766800 CCTGTGGAACTGCAGGAAGAGGG + Intronic
1150424976 17:65070042-65070064 CCCTCAGAAATGCAGGAAGAAGG - Intergenic
1152091945 17:78252022-78252044 CCAACAGAAATGGAGGAATGTGG + Intergenic
1152511942 17:80795935-80795957 CTTACAGAACTACAGGAATGTGG - Intronic
1153436039 18:5068978-5069000 TCTACAGAACTGCATAAATATGG - Intergenic
1153653921 18:7265245-7265267 CCTACAGAAGTTCAGAAATTAGG + Intergenic
1153991161 18:10401990-10402012 CCCACAGAACTGAAGGAGGAAGG + Intergenic
1154295575 18:13144113-13144135 CCTACAGAACTGTGAGAAAAAGG - Intergenic
1156159230 18:34340350-34340372 CCTACAGAACTGCAGGACTGCGG + Intergenic
1157596121 18:48864896-48864918 GCTGCGGAACTGCAGGAATGAGG - Intergenic
1158244096 18:55411219-55411241 CCTAGAGACCTGAAGGACTAAGG + Intronic
1164139803 19:22448956-22448978 CCTACAGAAATGGTTGAATAGGG - Intronic
1164183565 19:22841148-22841170 CCTACAGAAATGGCTGAATAGGG - Intergenic
1164962530 19:32446297-32446319 CCTACAGGAAGGCAGGAAGAAGG + Intronic
926494137 2:13563001-13563023 CCTTCAGAAATTCAGGAATGAGG + Intergenic
928749953 2:34459392-34459414 CCTTCAGAACCACAGGAATGGGG + Intergenic
931465842 2:62486187-62486209 CCTGTAAATCTGCAGGAATAGGG + Intergenic
932209886 2:69918443-69918465 TCCATAGAACTGCTGGAATATGG + Intronic
932919538 2:75894823-75894845 ACTCCAGAACTGGAGAAATAGGG + Intergenic
934519457 2:95010742-95010764 CCTGCAGAGCTGCAGGAGTGGGG + Intergenic
936061542 2:109298332-109298354 GCTCCAGAACTGCAGGGACAAGG - Intronic
937683437 2:124668976-124668998 CCAATAGGACTGCAGGAAGAAGG - Intronic
940410495 2:153358064-153358086 CCTGCAGAACTGCAAGCACATGG - Intergenic
944389694 2:199204741-199204763 CCTTAAGAAGTGCAGGAATTTGG - Intergenic
944647974 2:201799064-201799086 TCAACAGAACTGCAGGCACATGG - Intronic
946486544 2:220105944-220105966 CTTACAGAACTGAAGGAAGATGG - Intergenic
946772423 2:223102135-223102157 CCTACTGCACTGCAGGATTTAGG + Intronic
947748475 2:232521307-232521329 CCGACAGAACTGCTGGGACAGGG - Exonic
1171195584 20:23195825-23195847 ACTACAAAACTGCAGTAATCAGG + Intergenic
1172388507 20:34550194-34550216 GCCACAGAACGGCAGGAATGAGG + Intronic
1173705336 20:45106197-45106219 CTCACAGAACTGCTGGAACAGGG + Intergenic
1178280227 21:31275983-31276005 CCTCCAAAACTGCAGGAGAAAGG + Intronic
1180166035 21:46029649-46029671 ACTACAGAACCTCAGGGATAAGG + Intergenic
1180721662 22:17913653-17913675 ACTACAGTCCTGCAGGATTAGGG - Intronic
1185285171 22:49996852-49996874 CCTCCAGCCCTGCAGGCATAAGG + Exonic
949932011 3:9086174-9086196 ATTGCAGAAATGCAGGAATAGGG - Intronic
952489727 3:33856275-33856297 ATTCCAGAACTGCAGGAATATGG + Intronic
954891790 3:53937336-53937358 CCTAGATAACTGCAGGACGAAGG + Intergenic
959284719 3:104392475-104392497 CCTACAGCACTATAAGAATAGGG + Intergenic
959905881 3:111710850-111710872 CTTACAAATCTGCAGGAGTAAGG + Intronic
961434274 3:126905881-126905903 CTTCAAGAACTGCAGGAATCAGG + Intronic
962886461 3:139632431-139632453 CCTACAGAACTGGAGGTTGATGG + Intronic
962978818 3:140469607-140469629 ACTACAGAACAGTAGGAATGGGG - Intronic
963780724 3:149483586-149483608 TATACTGAACTGCAGGTATAAGG + Intronic
965306283 3:167067798-167067820 CCTACAAAACTTCAGGGATTTGG - Intergenic
965987333 3:174771399-174771421 CCAACAGAAGTGCAGTACTAGGG + Intronic
966740540 3:183229184-183229206 TCTAGAGAATTGCAGGAATAAGG - Intronic
966949608 3:184804263-184804285 CCTAAAGAACTGCAGAATTCTGG - Intergenic
967224213 3:187275414-187275436 CCTACAAGAGTGCTGGAATAAGG + Intronic
967510223 3:190302511-190302533 CCTCCCAAACTGCAGGATTATGG - Intergenic
971129698 4:23793275-23793297 CCTACAGAACAACAAGAATTAGG + Exonic
972863775 4:43205118-43205140 TCTAAAGAACTGGAGGAATTGGG - Intergenic
978010755 4:103680273-103680295 CCTACAGAACAGAAAGAAAATGG + Intronic
979226293 4:118289316-118289338 CCTACATCACTGCAAGAATTAGG + Intronic
982785848 4:159535961-159535983 CCTGCAGGACAGAAGGAATAGGG - Intergenic
983338479 4:166426140-166426162 TCTAGAGAATTGCAGAAATACGG - Intergenic
986401951 5:7391269-7391291 CCTAGAGAGGTGCAGGAAGAGGG - Intergenic
993816813 5:92558728-92558750 CCTCCTGCACTGCAGGAATGAGG - Intergenic
995331421 5:110951135-110951157 CCTACAGGTCTGCAGCAATTTGG - Intergenic
996591224 5:125149899-125149921 CATACAGAACTGCCTGAATGTGG - Intergenic
999653903 5:153794462-153794484 CCAACATCACTGCAGGAATTGGG - Intronic
999821973 5:155237447-155237469 CCTTCAGAACTGCAGAACAAGGG + Intergenic
999917270 5:156276477-156276499 CCTTCAGTGCTTCAGGAATAAGG + Intronic
1003331274 6:5130488-5130510 CCTGCAGAACTGTAGGCACATGG + Intronic
1006961533 6:37935714-37935736 CCCAGTGAACTGCAGGAGTATGG + Intronic
1016984838 6:149887348-149887370 CCCACAGAGCTGCAGGCAAAGGG - Intronic
1017376122 6:153770662-153770684 CGAACAGACCTGCATGAATATGG + Intergenic
1017985730 6:159441769-159441791 CCCACAGAACTGCAAGTAAATGG - Intergenic
1018226844 6:161636838-161636860 CCTACAGAAAGGCAGGAGGAGGG + Intronic
1018810712 6:167295954-167295976 ACTAAAGAACTGCAGGGACATGG + Intronic
1020746558 7:12086489-12086511 GCTACAGAAGTGCAGGAATGGGG + Intergenic
1021286742 7:18789706-18789728 CATACAGATATGCAGGATTAAGG - Intronic
1022909441 7:34886066-34886088 GCTACATCACTGCAGGAATGAGG + Intergenic
1033293838 7:140113567-140113589 CCTACAGAACTGAGAGAAGATGG - Exonic
1033566990 7:142588310-142588332 CCTGCAGAACTGGAGGATTCTGG + Intergenic
1034044944 7:147917825-147917847 ACTCCAGAACTGCAGGAGTCTGG - Intronic
1040761377 8:50849446-50849468 CCTACAGCACTTCAGGTCTAGGG - Intergenic
1041245519 8:55885197-55885219 CCTATAGAACTGCATGAATCGGG + Intronic
1041400026 8:57432960-57432982 CCTAGAGAAATGCAGGAATATGG + Intergenic
1052738510 9:32370278-32370300 CCTACAGGGATGCAGGAATGCGG + Intergenic
1056208873 9:84346342-84346364 ACTATAGAACTGCATGCATAAGG - Intergenic
1056574378 9:87843543-87843565 CCTGCAGGACTGCAGGACTGCGG + Intergenic
1058233849 9:102464447-102464469 CTCACAGAACTGCAGAAACAAGG + Intergenic
1059057838 9:111003294-111003316 CCTACTAAACTCCAGGGATAGGG - Intronic
1060297862 9:122355389-122355411 CCTACAGAAAGGCAGGAAGCTGG + Intergenic
1186447324 X:9642804-9642826 CCTACAGAAATGTATGAACATGG + Intronic
1188995999 X:36887020-36887042 CCTACAAAACTGTAGAAATTAGG - Intergenic
1189732761 X:44038880-44038902 CCTGCTGAACTACAGCAATACGG - Intergenic
1192222095 X:69204199-69204221 CCTACAGACATGGAGGAATTTGG + Intergenic
1197440687 X:126485468-126485490 CCAACAGCTCTGCAGGAATTTGG + Intergenic
1200642163 Y:5734101-5734123 CAGACAGAACTCCAGGAATTTGG - Intronic
1201460208 Y:14213999-14214021 TCTACAGACCTGCAGGAAGCTGG - Intergenic