ID: 922464374

View in Genome Browser
Species Human (GRCh38)
Location 1:225836737-225836759
Sequence CAAACTCAGCAGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922464372_922464374 4 Left 922464372 1:225836710-225836732 CCACCTATAGAAGGAATCTGAAA 0: 1
1: 0
2: 2
3: 25
4: 240
Right 922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG 0: 1
1: 1
2: 0
3: 27
4: 316
922464370_922464374 14 Left 922464370 1:225836700-225836722 CCGCATGATTCCACCTATAGAAG 0: 1
1: 0
2: 4
3: 26
4: 203
Right 922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG 0: 1
1: 1
2: 0
3: 27
4: 316
922464373_922464374 1 Left 922464373 1:225836713-225836735 CCTATAGAAGGAATCTGAAATAG 0: 1
1: 0
2: 2
3: 21
4: 226
Right 922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG 0: 1
1: 1
2: 0
3: 27
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922464374 Original CRISPR CAAACTCAGCAGAAGCAGAG AGG Intronic
900109899 1:1000966-1000988 CGAACTCAGCAGCAGCAAAGTGG + Intergenic
901840132 1:11949144-11949166 CAACTTCAGCAGAAGGAGACAGG + Intronic
903102174 1:21040171-21040193 CAACCTCAGGGGAAGGAGAGGGG + Intronic
903623375 1:24714277-24714299 CAGACCCAACAGGAGCAGAGTGG + Intergenic
904414848 1:30353885-30353907 CAAACTCAGCAGAAATTTAGGGG - Intergenic
904745291 1:32707030-32707052 CAAACCCAGGAGGAGGAGAGAGG + Intergenic
905026715 1:34855516-34855538 CAGACCCAGCAGCAGCCGAGGGG - Exonic
905267580 1:36765276-36765298 CACAGTGAGGAGAAGCAGAGGGG - Intergenic
906198437 1:43944442-43944464 AAAACTCAGCAGAGGAGGAGAGG - Intergenic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
907659743 1:56381049-56381071 CAAACTTAGAAGAAGGAGAAAGG + Intergenic
907742112 1:57176754-57176776 CAAACTCACCTGGAGAAGAGAGG + Intronic
910262325 1:85304406-85304428 CACACTCAGCTGAAGTAAAGAGG - Intergenic
912173614 1:107130968-107130990 CAAACTCAGGAAAGGCAGAAAGG - Intergenic
912372831 1:109187043-109187065 CAGACTGAGCAGAACCAGTGCGG - Intronic
912679133 1:111717709-111717731 CGAATTCAGCAGAAGCAGTCTGG + Intronic
912723494 1:112039663-112039685 CACACTCAGCAGCTACAGAGAGG - Intergenic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
914920290 1:151842224-151842246 CAAATTCAGCAGCAGCGGTGAGG - Intergenic
915166165 1:153948897-153948919 CAAGCTGAGCAGAAATAGAGGGG + Intronic
915487599 1:156232675-156232697 CAAACTCAGCAAAGGCTGATGGG + Intronic
916260454 1:162836726-162836748 CAATCTGAACAGAAGCAGAAAGG - Intronic
916424071 1:164664044-164664066 CAAACTCACCAAATGCAAAGTGG - Intronic
916810669 1:168302835-168302857 CACACTCGGCAGAAATAGAGAGG + Intronic
917609587 1:176673369-176673391 CAAAAGCAACAGTAGCAGAGGGG + Intronic
918321582 1:183370090-183370112 CAACCTGATCAGAAGCAGAAGGG + Intronic
921704337 1:218304425-218304447 CAAACTGTACAGAAGCAGAAGGG - Intronic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
922548637 1:226477460-226477482 CCATCTTAGCAGAAGCAGACTGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1062987825 10:1785708-1785730 CAAGCTCAGCAGGTGCACAGAGG - Intergenic
1063702583 10:8400092-8400114 CACACCCAGCAGAACCAAAGAGG - Intergenic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065461125 10:25965740-25965762 TAAACTCAGCCTAGGCAGAGGGG - Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1067251933 10:44593984-44594006 GACAGTGAGCAGAAGCAGAGTGG + Intergenic
1067926212 10:50511146-50511168 CAGACCCAGTAGAGGCAGAGTGG + Intronic
1068576954 10:58694816-58694838 GTAACTGAGCAGCAGCAGAGTGG - Intronic
1069776865 10:70932432-70932454 CAAATCCAGCAGAAACAGATGGG - Intergenic
1069849043 10:71393262-71393284 CACAGGCAGCAGAAGCAGAAGGG - Intergenic
1069921982 10:71821154-71821176 CACACTCTGCACATGCAGAGAGG + Intronic
1070780318 10:79133767-79133789 CAAAGTTAACAGAAACAGAGGGG - Intronic
1070923378 10:80203062-80203084 AAAAGACAGCAGAAGAAGAGGGG + Intronic
1070948465 10:80412054-80412076 CACACCCAGCAGAAGAACAGTGG + Intronic
1071438296 10:85667045-85667067 GGAACTAAGCAGAGGCAGAGAGG + Intronic
1071759702 10:88587371-88587393 TAAAATCAACAAAAGCAGAGAGG + Exonic
1072056905 10:91767208-91767230 AAAACTCTGCAGGAGCATAGAGG - Intergenic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1073833596 10:107415381-107415403 AAAACTCAGCAGAGCAAGAGGGG + Intergenic
1074153336 10:110778073-110778095 CAAATTCAACAGCAGCAGAATGG - Intronic
1075002542 10:118809057-118809079 CAAACGCAGCAGTTGCAGACAGG - Intergenic
1075206690 10:120455325-120455347 CAAACTCAGCAGATGCTTATAGG + Intergenic
1075945632 10:126430699-126430721 CTCATTCAGCAGAAGCAGACAGG + Intronic
1076486457 10:130822205-130822227 GAAACACAGCACAGGCAGAGTGG + Intergenic
1076887302 10:133268590-133268612 CAAACTCAGCCCAAGCCGGGGGG + Intronic
1077783010 11:5352384-5352406 AAAACTAAGCAGATTCAGAGTGG + Exonic
1079088961 11:17467446-17467468 AAAATTCAGAAGAAGAAGAGTGG - Intronic
1080479260 11:32629105-32629127 CAATCCCAACTGAAGCAGAGAGG + Intronic
1080593384 11:33744320-33744342 CACAAACAGCAGATGCAGAGAGG + Intronic
1081286427 11:41275459-41275481 CAAACACAGAAGCAGAAGAGTGG + Intronic
1081328196 11:41771592-41771614 CAAATTCAGAGGAAGCTGAGAGG + Intergenic
1081567946 11:44271113-44271135 CAAACACAGCAGAGGCAGGCAGG + Intronic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082178785 11:49093437-49093459 CAAAATCAACAGAAATAGAGGGG - Intergenic
1082654426 11:55836147-55836169 CAAGCTCTCCAGAGGCAGAGGGG + Intergenic
1084601515 11:70148630-70148652 GAAAATCAGCAGAGGCTGAGGGG - Intronic
1085704323 11:78772413-78772435 AAGACTGAGCAGCAGCAGAGAGG - Intronic
1085724715 11:78944220-78944242 CAACCTCTGCAGAAGCAGTTTGG + Intronic
1086063527 11:82723922-82723944 CAAACTCAGCTGAACCTCAGTGG + Intergenic
1087265142 11:96052501-96052523 AAAACTGGGCAGAAGCAGAGTGG - Intronic
1087625769 11:100594529-100594551 CACACACAGCAGCAGCAGAGTGG - Intergenic
1087914760 11:103797259-103797281 CCAACAGAGCAGGAGCAGAGAGG + Intergenic
1089623106 11:119734038-119734060 CAAACTTCTCAAAAGCAGAGAGG - Intergenic
1089912580 11:122116938-122116960 CTTACTTAGCAGCAGCAGAGAGG + Intergenic
1091787420 12:3251589-3251611 GAAATTCACCAGAAGCAGAACGG - Intronic
1092237104 12:6817178-6817200 CAAACTCAGCATCAGCTTAGGGG - Exonic
1092510435 12:9149887-9149909 CAAAGTGAATAGAAGCAGAGAGG - Intronic
1093028710 12:14268433-14268455 CAAAAAAAGCAAAAGCAGAGAGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1096227144 12:49873372-49873394 CAAACACAGAAGGAGCAGAGCGG - Intronic
1096320444 12:50607651-50607673 TATAATCAGCAAAAGCAGAGTGG + Intronic
1096552714 12:52383935-52383957 CTAACTCAGCAGAAGCTGGAAGG + Intronic
1096868633 12:54579543-54579565 CAAAAACAGCAGCAGGAGAGAGG + Exonic
1097422928 12:59403190-59403212 CAACGTCAGCAAAAGCAGAAAGG - Intergenic
1097803695 12:63942674-63942696 AAAAAGCAGCAGAAGCAAAGTGG - Intronic
1099692909 12:85982949-85982971 CAAAGTCACCAGAAGCTGAAAGG + Intronic
1102074428 12:110048501-110048523 CCAGCCCTGCAGAAGCAGAGAGG + Intronic
1102624471 12:114223982-114224004 CAACGTAAGCAAAAGCAGAGAGG + Intergenic
1104355036 12:128077797-128077819 CAGATTCAGCAGAACCAGGGAGG + Intergenic
1104668081 12:130661700-130661722 CAAACTGTGCTTAAGCAGAGAGG - Intronic
1106770679 13:32958141-32958163 CCAAGTAAGCACAAGCAGAGGGG - Intergenic
1107958606 13:45540392-45540414 CCAAGTCAGCAGAAGCTGACTGG + Intronic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1110512871 13:76373634-76373656 GAAAGTGAGCAGAAGCATAGAGG + Intergenic
1111727482 13:92030859-92030881 AAAACTCAGCAGAGCGAGAGAGG - Intronic
1111785334 13:92779124-92779146 CAATCACAGCAGAAGGAGAAAGG + Intronic
1112680721 13:101761977-101761999 CAAAATCAGCAGAATCAAAAAGG - Intronic
1112877107 13:104056471-104056493 CAAACTCAAAGCAAGCAGAGGGG - Intergenic
1113418589 13:110151855-110151877 CAAATTCAGCTGAAACTGAGAGG - Intronic
1114185083 14:20395130-20395152 GAATCAGAGCAGAAGCAGAGAGG + Intronic
1114652208 14:24292390-24292412 CATTCACAGTAGAAGCAGAGAGG - Intronic
1116079294 14:40153559-40153581 CACACCCAGCAGCAGCTGAGTGG + Intergenic
1116493688 14:45536181-45536203 CAAACTGATCAGAAGCTGAAGGG - Intergenic
1117116083 14:52514001-52514023 CAAAATCAGCAGAATGAGACAGG + Intronic
1117284823 14:54277191-54277213 CAAACTCAGGAGGAGCTGTGGGG - Intergenic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1119869601 14:78004815-78004837 AAACCTCAGAAGAAGCAGTGGGG - Intergenic
1121345757 14:93134737-93134759 CACACTCTGCAGAGTCAGAGAGG + Intergenic
1121421296 14:93817348-93817370 AAAACTCATCAGAAACAAAGCGG - Intergenic
1121442249 14:93956587-93956609 CCATCTCAGCAGGAGCAGTGGGG + Intronic
1121640314 14:95480900-95480922 CCATCTCAGCAGCAGCAGAAGGG + Intergenic
1122903498 14:104791667-104791689 CAAACACAGCTGGAGCAGACAGG - Intronic
1127006985 15:54581810-54581832 CAAACTCAGCAGCACCAAAAAGG - Intronic
1127210279 15:56767156-56767178 CAAAATCAGAAGTAGCACAGTGG + Intronic
1130101487 15:80897753-80897775 TAAATTCAGCAAAAGCAGAGGGG + Intronic
1130190327 15:81728810-81728832 TAAAATCAGCACAAGCAGATTGG - Intergenic
1130408913 15:83627825-83627847 CAAACTCAGATGAAAAAGAGGGG - Intergenic
1130885210 15:88087152-88087174 CAAGCTCCCCAGAAGCAAAGTGG + Intronic
1133144047 16:3770542-3770564 CAAAAACAGCAGAGACAGAGAGG + Intronic
1133650480 16:7808136-7808158 CAAATTGAGCAGAAAAAGAGAGG + Intergenic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1134037206 16:11040128-11040150 CAATCTCAGCAAAAGAAGGGCGG - Intronic
1134665865 16:16018127-16018149 CAAACCCAACAGAACCACAGAGG - Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1139590143 16:67928822-67928844 GAAGCTCAGCAGAAGGGGAGAGG - Exonic
1140040852 16:71406695-71406717 CTAACTCAGGAGAACCAGGGAGG - Intergenic
1141138284 16:81480875-81480897 GGACCTCAGCTGAAGCAGAGTGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141456939 16:84149057-84149079 CACAGCCAGCAGAAACAGAGTGG + Exonic
1142242317 16:88953184-88953206 CAAACCCAGCCGAGGGAGAGAGG - Intronic
1142616764 17:1141089-1141111 AAAGCTCAGCTGAAGCCGAGTGG + Intronic
1142707537 17:1705904-1705926 AAAACGCAGCAGAAGCAGCAGGG + Exonic
1143428267 17:6858093-6858115 CAAAGTCAACAAAAGCAGTGAGG - Intergenic
1145290179 17:21537619-21537641 AACACTCAGCAAATGCAGAGGGG + Intronic
1147318292 17:39631547-39631569 CAACCTCCGCAGGAGCGGAGGGG - Intronic
1147403015 17:40192201-40192223 CAAACTCTGCAGAAGCTGCCAGG + Exonic
1148444388 17:47728647-47728669 GAAAGTCTGCAGAGGCAGAGAGG - Intergenic
1148701102 17:49587483-49587505 AAAACTCGCCAGAGGCAGAGTGG + Intergenic
1149512193 17:57252665-57252687 CAAAAAGAGCAGAAGCAGAAGGG + Intergenic
1151536881 17:74744238-74744260 CAAACGGAGCAGAAGAAGAAAGG + Intronic
1153412327 18:4807727-4807749 CAAACACAGCTGACTCAGAGAGG + Intergenic
1155479676 18:26271995-26272017 AAAACTCAGCAAAGCCAGAGGGG + Intronic
1155588618 18:27398669-27398691 AAAACCAAGCAGAAGTAGAGAGG - Intergenic
1155933268 18:31728359-31728381 TAAAAACAGCAGAACCAGAGTGG + Intergenic
1156235823 18:35203856-35203878 CATACTTAGCAGAAGGAGTGGGG - Intergenic
1156504564 18:37581132-37581154 CAAACTGGATAGAAGCAGAGGGG - Intergenic
1157068030 18:44374709-44374731 GAAAGTGAGCAGAAGCAGGGTGG + Intergenic
1157713929 18:49869493-49869515 CTAAGTCAACAGCAGCAGAGTGG + Intronic
1158788659 18:60747339-60747361 CAAAATCATGAGAAGTAGAGTGG - Intergenic
1162124958 19:8494443-8494465 AAAGCCCAGGAGAAGCAGAGGGG + Intronic
1164547715 19:29182991-29183013 CCTACTCGGCAGAAGCAGAGAGG - Intergenic
1165731042 19:38144979-38145001 GAAACACAGGAGAATCAGAGAGG + Intronic
1166382068 19:42360329-42360351 AAAAAACAGCAGAAGCAGAGAGG - Intronic
1167527347 19:49993220-49993242 CAAACTCAGCAGAGGGAAAAGGG + Intronic
926424647 2:12729793-12729815 CAAACCAAGCAGAGGCACAGTGG + Intronic
929031145 2:37650842-37650864 CAAACTCAGTAGAGGCAGTGGGG + Intronic
931169645 2:59789349-59789371 CAAACTCAGCATATCCAGAATGG - Intergenic
932331854 2:70902151-70902173 CACACCCAGCAGCCGCAGAGAGG - Intronic
933606991 2:84393629-84393651 CACAGACAGCAGAGGCAGAGTGG - Intergenic
933766167 2:85711117-85711139 AAAACTCAACAGAGGCAGAGTGG - Intergenic
937149271 2:119674675-119674697 CAAACCCACAAGTAGCAGAGAGG + Intergenic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
938106010 2:128530283-128530305 GAAATGCAGCAGAAGCAGACAGG - Intergenic
939517383 2:143186027-143186049 CAAACTCAACAGAAGCTTAATGG - Intronic
940236490 2:151516460-151516482 GAGTCTCAGCAGATGCAGAGTGG - Exonic
940494491 2:154408071-154408093 CAAACTTTTCAAAAGCAGAGTGG + Intronic
941536411 2:166727511-166727533 CAAAGTCAACAAAAGCAGTGAGG + Intergenic
943304026 2:186237042-186237064 CAAACACAGCAGAAGGCAAGGGG - Intergenic
944334697 2:198518323-198518345 GAAACTCAGCCGAAGCAAAATGG + Intronic
944912598 2:204325020-204325042 AAAACTCACCGGAAGCTGAGGGG + Intergenic
945712485 2:213316177-213316199 CAAATGCAGGAGGAGCAGAGTGG - Intronic
945992895 2:216411552-216411574 CAAACTGTTCAGGAGCAGAGTGG - Intergenic
1169821816 20:9720047-9720069 TAAACTCAGCAGAATCAGCTTGG - Intronic
1170927635 20:20740519-20740541 CAAAGGCAGGAGAAGCACAGAGG - Intergenic
1171315983 20:24195117-24195139 CAAACTCAGTAGTAGCTGTGAGG - Intergenic
1172225988 20:33305720-33305742 CAAATTCAGCTGCAACAGAGTGG + Intronic
1172582957 20:36063265-36063287 CATAGTCAGCAGAAGCAAAGAGG + Intergenic
1174282634 20:49450270-49450292 CAAACTCAGCAGTCACTGAGTGG - Intronic
1175040031 20:56040291-56040313 CCAAGTCAGCATTAGCAGAGTGG - Intergenic
1175322615 20:58100132-58100154 ACATCTCAGCTGAAGCAGAGAGG + Intergenic
1175361975 20:58419381-58419403 CAGACTCAAGAGAAGCACAGGGG - Intronic
1177717205 21:24854357-24854379 CATAACCAGCAGAAGCAGAAAGG + Intergenic
1178630259 21:34253409-34253431 TAAAATGGGCAGAAGCAGAGCGG + Intergenic
1179613994 21:42569936-42569958 GAAACGCAGCAGCAGCAGCGTGG - Intronic
1181577425 22:23803770-23803792 CTCACACAGCAGAAGCAGAGTGG - Intronic
1181832325 22:25570722-25570744 AAGACACAGGAGAAGCAGAGGGG - Intronic
1182836117 22:33342724-33342746 CAAACTAGACAGATGCAGAGCGG - Intronic
1183009718 22:34934862-34934884 AAAACTAGCCAGAAGCAGAGAGG + Intergenic
1183365878 22:37406595-37406617 CTAATTGAGCAGATGCAGAGCGG - Intronic
1183578620 22:38708682-38708704 CTACTTCAGGAGAAGCAGAGAGG + Intronic
1185365746 22:50435954-50435976 CAAACTCAGCAGCAGCCTACAGG - Intronic
949264386 3:2139788-2139810 AAAACACATCAGAAGCAGAGTGG - Intronic
949980261 3:9498415-9498437 TAAACCCAGCAGCAGCAGAAGGG + Exonic
950038317 3:9902989-9903011 CAATCCCAGCAGAGTCAGAGAGG - Exonic
951768753 3:26230859-26230881 GAAACTCAGAAGAAGGTGAGGGG + Intergenic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
953238944 3:41131246-41131268 CAAACTCTGTATAAGCAAAGAGG + Intergenic
954301536 3:49703153-49703175 TTCACTCAGGAGAAGCAGAGAGG - Intronic
954460967 3:50626702-50626724 CAAACACTGCAGAATCAGAATGG + Intronic
954847470 3:53572344-53572366 CAAACAAACCAGAGGCAGAGAGG - Intronic
957740548 3:84262125-84262147 CAATCACAGGAGAAGCACAGTGG + Intergenic
957911056 3:86620547-86620569 GAAACTCAGGAGAAGGACAGAGG + Intergenic
958148386 3:89657587-89657609 TAAAGTGGGCAGAAGCAGAGTGG + Intergenic
960089631 3:113626182-113626204 AAAACAGAGCAGTAGCAGAGAGG - Exonic
960205716 3:114895138-114895160 CAAACTCAACAGTAGAAAAGTGG - Intronic
961454802 3:127018616-127018638 TAAACTGAGCTGAAGCAGGGTGG - Intronic
962218079 3:133540102-133540124 CAAAATCCCCAGAGGCAGAGGGG - Intergenic
963390462 3:144657309-144657331 GAAACTCAGAAGAAGCAGTCAGG - Intergenic
963851609 3:150215782-150215804 CAACCACAGCTGCAGCAGAGTGG + Intergenic
963906198 3:150775072-150775094 CCAACCCAGCAGGGGCAGAGGGG + Intergenic
963969277 3:151411431-151411453 CAGATTCAGCAGCAGCCGAGTGG + Exonic
964147189 3:153478966-153478988 CAAACTAAACAGCAGGAGAGAGG - Intergenic
967645309 3:191915877-191915899 AAAACTCAGTAGAAACAGATGGG - Intergenic
967822941 3:193855114-193855136 AAAACTCAGCAGGAGCTGAGGGG - Intergenic
968732463 4:2276081-2276103 TAAACCCTGCAGAAGCACAGAGG + Intronic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
969428635 4:7140158-7140180 CTTACACAGCAGAAACAGAGAGG + Intergenic
970423273 4:15924498-15924520 GAAACCAAGCAGAAGCAGTGCGG - Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971122076 4:23715908-23715930 AAAACAAAGCAGAAGCAGTGTGG + Intergenic
971521967 4:27564977-27564999 CAAACTCAAAGGAAGAAGAGGGG - Intergenic
971935361 4:33140675-33140697 CAAAATTAGCACAAGCAGATGGG + Intergenic
972021728 4:34323851-34323873 AAAGCTCAGCAGAGGAAGAGAGG + Intergenic
973019448 4:45183904-45183926 CAATCTCAGCAGCAACAGATTGG - Intergenic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
979678333 4:123433730-123433752 CACACTCAGCACAAGCACAGAGG + Intergenic
980397152 4:132228332-132228354 TAAAGGAAGCAGAAGCAGAGGGG + Intergenic
981663454 4:147194777-147194799 CAAAGCCAGCAGAGGCAGAAAGG - Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982250025 4:153395844-153395866 AAAAGACAGGAGAAGCAGAGTGG - Intronic
982721020 4:158860191-158860213 CCAACTCAGCATGATCAGAGAGG - Intronic
983510440 4:168604151-168604173 CAAATTCTGTAGAAGCTGAGAGG + Intronic
984783156 4:183544199-183544221 CCAAGTCAGCACAAACAGAGAGG - Intergenic
985698089 5:1353212-1353234 GAAAGTCACCAGAAGGAGAGTGG - Intergenic
985861622 5:2476024-2476046 AAAACTCAGCAGAAGCAGAGGGG + Intergenic
985940534 5:3132262-3132284 CAAAGTCAACAGCAGCAGAGAGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
988179260 5:27767905-27767927 CATACTAAGCAGAATCAGAAAGG - Intergenic
988485485 5:31665192-31665214 CAAGCTCAGGAGGAGAAGAGGGG - Intronic
988496082 5:31747462-31747484 AAAAAACAGCAGAAGCAGGGAGG - Intronic
989091317 5:37736013-37736035 CAAACACAGCAGGATCACAGAGG + Intronic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990294814 5:54390248-54390270 CAAACTCAGCAGTTGCTGTGTGG - Intergenic
990533879 5:56700958-56700980 CAAAATTAGCAGAAGCTGGGAGG + Intergenic
993337881 5:86683999-86684021 CAAAATGAGCATAAGAAGAGAGG + Intergenic
993861786 5:93145264-93145286 CACACTGAGCAGACGCAGAGTGG - Intergenic
993956067 5:94234610-94234632 CAATCATAGCAGAAGCAAAGGGG + Intronic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
995062287 5:107823781-107823803 CAATCACAGCAGAAGGAGAAGGG - Intergenic
995105642 5:108374962-108374984 CAAACTAAGCAGAAACAAGGGGG + Intronic
996128493 5:119753168-119753190 CAAACTCAGGGGGAGCACAGTGG + Intergenic
997384836 5:133464500-133464522 CAAACACAGCATCAGCAGAGGGG + Intronic
997692666 5:135837251-135837273 TAAACTGGGCAGAGGCAGAGAGG - Intronic
998041695 5:138954537-138954559 GAAACACAGCAGAGGAAGAGGGG + Intronic
999927388 5:156393852-156393874 AAAACTCACCAGCAGCAAAGTGG - Intronic
1000205057 5:159050767-159050789 CAAACTCAGAAGAAACCCAGCGG + Intronic
1001075371 5:168623190-168623212 CAAACTCACCAGAAACAGAATGG - Intergenic
1001313885 5:170629472-170629494 CAAGGCCTGCAGAAGCAGAGAGG + Intronic
1001399815 5:171439734-171439756 CCAACTCCTCAGAAGGAGAGGGG + Intronic
1002774718 6:318804-318826 CATATTCAGCAGAAGGGGAGTGG + Intronic
1003245986 6:4382645-4382667 GAAAATCTGCAGAAGCAGATTGG + Intergenic
1003327454 6:5103231-5103253 CAAACACAGAAGAAGCGGGGAGG + Intronic
1003363509 6:5450931-5450953 CAAACAAAGCAGAAGATGAGGGG - Intronic
1003393495 6:5733131-5733153 CAATCTCCGCAGAGGCAGAAGGG - Intronic
1003476838 6:6491340-6491362 CAACCTCTCCAGAAGTAGAGTGG - Intergenic
1003508527 6:6759864-6759886 CAAGCTCTACAGAAGCAGCGCGG - Intergenic
1004202062 6:13558153-13558175 CATCCTCAGCAGAGACAGAGTGG + Intergenic
1004340620 6:14804658-14804680 CAAACCCTGCAGAGGCACAGGGG + Intergenic
1006242846 6:32700949-32700971 CAATCTGAGCAGAAGCTGTGAGG - Intergenic
1006251110 6:32786329-32786351 CAATCTGAGCAGAAGCTGTGAGG - Intergenic
1006375902 6:33671458-33671480 CCACCTCAGCAGGACCAGAGGGG + Intronic
1007843034 6:44732101-44732123 CAAAGTCTGAAGAAGCTGAGAGG + Intergenic
1009669036 6:66721535-66721557 GAAATTCAGCAGAGGCAGAAAGG + Intergenic
1009669040 6:66721586-66721608 GAAATTCAGCAGAGGCAGAAAGG + Intergenic
1009695907 6:67102389-67102411 CAAACCCAGCACATGGAGAGGGG - Intergenic
1009750975 6:67879132-67879154 CAAAAACAGCAGAAGCAGAAAGG + Intergenic
1009797763 6:68494609-68494631 GAAAGAGAGCAGAAGCAGAGTGG + Intergenic
1011044417 6:83066015-83066037 CACGCTCATAAGAAGCAGAGTGG - Intergenic
1016074043 6:139775362-139775384 CACACATAGCAGAGGCAGAGTGG + Intergenic
1017300632 6:152853524-152853546 CAAACTAAGCATAAACAGAATGG - Intergenic
1018380032 6:163250408-163250430 CTAATTCTGCAGAAGCAGTGTGG - Intronic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1021502438 7:21345795-21345817 GACAGTCAGCAGAAGCAGGGTGG - Intergenic
1022735113 7:33069028-33069050 CAAAGTCCACAGAAGCTGAGAGG + Intergenic
1023017721 7:35983735-35983757 CAAACCCAGCAGGACCAGTGAGG + Intergenic
1023860890 7:44217248-44217270 GAAACTCAGCAAAAAGAGAGAGG + Exonic
1025072320 7:55910952-55910974 CACAGTCAGGAGAAGCAGACGGG - Intronic
1028311003 7:89335720-89335742 CAAACACTGCAGAAGGAGAGAGG + Exonic
1032271013 7:130405924-130405946 CAGACACCGCAGAAGCAGAGAGG + Intronic
1034591478 7:152143589-152143611 CAAACACAGAGGAAACAGAGGGG + Intronic
1037372094 8:18191024-18191046 GTCACTCAGCAGAAGCACAGTGG - Intronic
1037481810 8:19312979-19313001 AAAATTGAGCAGAAGCACAGTGG - Intergenic
1039197409 8:35048014-35048036 CAGACTCTGCAGAGCCAGAGAGG - Intergenic
1041535802 8:58924339-58924361 CATACTAAGCAGAAGTAGGGAGG + Intronic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1041971700 8:63750573-63750595 CCAACTCTGCAGAACCAGTGTGG - Intergenic
1042000703 8:64121113-64121135 GAAACTCAGAAGAAGGAAAGTGG + Intergenic
1042347890 8:67746472-67746494 CAAACAAACCAAAAGCAGAGAGG - Intergenic
1042833114 8:73053084-73053106 GAAGCACAGCAGAAGCACAGAGG + Intergenic
1043299266 8:78706065-78706087 CAAACCAACCAGAGGCAGAGAGG - Intronic
1045406321 8:101870101-101870123 CTAACTCACCAGACGAAGAGGGG + Intronic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1047502553 8:125453500-125453522 CAACCTGAGCAGAAGCTCAGTGG + Intergenic
1047777857 8:128088389-128088411 CACTTTCAGCAGCAGCAGAGGGG + Intergenic
1048693406 8:136994384-136994406 ACAACTCAGCAAAAGCATAGAGG + Intergenic
1048726371 8:137389815-137389837 CAAACACAGCATATGGAGAGAGG - Intergenic
1049568824 8:143358786-143358808 AAAACACAGCAGCAGCTGAGAGG + Intronic
1049595871 8:143483120-143483142 CGAAGTCAGCAGAAGAGGAGCGG + Intronic
1051917827 9:22229429-22229451 AAAACACAGAAGAAGCAGATGGG - Intergenic
1052323628 9:27194265-27194287 CAATCTCTGCAGAAGAAAAGTGG - Intronic
1052346767 9:27417592-27417614 GATTCTCAGCAGAAGCTGAGAGG - Intronic
1052473455 9:28929043-28929065 CAAATTCAACAAAAGCAGAGGGG + Intergenic
1053344952 9:37371402-37371424 CAAACACAGCAGGAGCACAGGGG + Intergenic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1054823561 9:69548141-69548163 CCAAGTCAGCAGCAGGAGAGGGG - Intronic
1055197218 9:73611056-73611078 CAAAGTCAGAGGAAGCTGAGAGG + Intergenic
1055376472 9:75654100-75654122 CAAACTGTGCAGAAGCTCAGTGG + Intergenic
1056296053 9:85194030-85194052 CAATCTCAGCAGAAAGAGTGTGG - Intergenic
1056623003 9:88230146-88230168 CAGACTCACCAGAAGTAGACAGG - Intergenic
1057020255 9:91691850-91691872 AAAACCCAGCAGAAAAAGAGGGG + Intronic
1057521664 9:95765194-95765216 AAAACTCATCAGAAGGAGACAGG - Intergenic
1059899385 9:118905830-118905852 TAAACTCTGCAAAAACAGAGGGG + Intergenic
1059988229 9:119840387-119840409 CAAATTCCACAGAAGCACAGAGG + Intergenic
1061306215 9:129734716-129734738 CGAACTGACCAGAGGCAGAGTGG - Intergenic
1186599890 X:11025091-11025113 GAAGGTGAGCAGAAGCAGAGTGG - Intergenic
1187284354 X:17889635-17889657 GAGACTCAGCTAAAGCAGAGAGG + Intergenic
1187704549 X:21996631-21996653 AAAAGTCAGCAAAAGCAGAGGGG - Intergenic
1188996148 X:36888108-36888130 TCAACTTTGCAGAAGCAGAGGGG - Intergenic
1189117294 X:38356480-38356502 AAAACTCAGCAAAGCCAGAGGGG + Intronic
1191909027 X:66127511-66127533 GAAAGTGAGCAGAAGCAGTGTGG - Intergenic
1192381271 X:70618999-70619021 CAGACTCAGCAGAAAAACAGAGG - Intronic
1192431128 X:71112317-71112339 GAAACACCACAGAAGCAGAGTGG - Intergenic
1192673771 X:73173078-73173100 CAAACCCAGCAGAAAAAAAGAGG - Intergenic
1193775369 X:85635073-85635095 CAATCTCTGCATAAGAAGAGTGG - Intergenic
1196199765 X:112872247-112872269 CAACATCAGTAGAAGCAGATAGG + Intergenic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1201271184 Y:12255650-12255672 CAAACTCAGAAGTAGAATAGTGG + Intergenic
1201611801 Y:15851524-15851546 GAAAGTGAGCAGAAGCAGAGTGG + Intergenic
1201649591 Y:16270690-16270712 CAATCACAGCAGAAGGAGAAAGG - Intergenic
1201738577 Y:17298910-17298932 TAAATCCAGCAGAAGCAGAAAGG + Intergenic
1201761878 Y:17549275-17549297 CAAAGTAAACAGAAACAGAGTGG - Intergenic
1201839674 Y:18356715-18356737 CAAAGTAAACAGAAACAGAGTGG + Intergenic
1201909967 Y:19124174-19124196 CAAAGACAGGAGCAGCAGAGGGG - Intergenic