ID: 922474550

View in Genome Browser
Species Human (GRCh38)
Location 1:225898301-225898323
Sequence GCAAGGATCTTAGATGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474550_922474559 15 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474559 1:225898339-225898361 GTTAACGAGAGCACTGTAGGGGG No data
922474550_922474558 14 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
922474550_922474563 22 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474563 1:225898346-225898368 AGAGCACTGTAGGGGGGCAGGGG 0: 1
1: 0
2: 1
3: 33
4: 344
922474550_922474560 16 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
922474550_922474562 21 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474562 1:225898345-225898367 GAGAGCACTGTAGGGGGGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 304
922474550_922474556 12 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474556 1:225898336-225898358 ATTGTTAACGAGAGCACTGTAGG No data
922474550_922474564 25 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474564 1:225898349-225898371 GCACTGTAGGGGGGCAGGGGAGG 0: 1
1: 1
2: 2
3: 72
4: 905
922474550_922474561 20 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
922474550_922474557 13 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474550 Original CRISPR GCAAGGATCTTAGATGCTCT GGG (reversed) Intronic
901066239 1:6496061-6496083 GCATGGGTCTGAGATGCTTTGGG - Intronic
902302734 1:15513855-15513877 GCAAGGAGCTCAGAGTCTCTGGG + Intronic
902635628 1:17733380-17733402 GCAAGGATCTTAACCTCTCTGGG + Intergenic
905348745 1:37329854-37329876 GCAAGCTTCTTAAATTCTCTGGG - Intergenic
907572833 1:55499592-55499614 GCAAGTACCATAGATGCTTTCGG - Intergenic
914341667 1:146765208-146765230 GCAAGCATCTTTTATGCTGTAGG + Intergenic
922474550 1:225898301-225898323 GCAAGGATCTTAGATGCTCTGGG - Intronic
924238178 1:242016410-242016432 CCTTGCATCTTAGATGCTCTTGG + Intergenic
1063109659 10:3024032-3024054 TCAATGTTCTTAGATGCTCTTGG + Intergenic
1063948721 10:11202837-11202859 GCAAGGAGCTAAAATGCTCTAGG - Intronic
1068137342 10:52964266-52964288 GCAAGTGACTTAAATGCTCTAGG - Intergenic
1071873873 10:89822838-89822860 GCAAGGATCTCAGACACTCCTGG + Intergenic
1071994972 10:91138817-91138839 TTAATGATTTTAGATGCTCTGGG - Intergenic
1075986984 10:126796794-126796816 GCATGGATCTGAGATGTTCTTGG - Intergenic
1076060261 10:127408440-127408462 GCCAGGAACTTAGTAGCTCTCGG + Intronic
1078745182 11:14106850-14106872 GGAAGGTTCCAAGATGCTCTGGG - Intronic
1081307351 11:41529801-41529823 CCAAAAATCTTGGATGCTCTTGG - Intergenic
1083600025 11:63941080-63941102 GCAAGGATCGCAGAATCTCTGGG - Intronic
1089625300 11:119747352-119747374 GAGAGGATCCTGGATGCTCTAGG - Intergenic
1089751160 11:120652238-120652260 CTAAGGTTCTTAGAAGCTCTGGG - Intronic
1090481316 11:127071172-127071194 TCAAGGAGCTTAGATTCTATGGG - Intergenic
1096019520 12:48311660-48311682 GCAAGGATCTTAGACTTTTTAGG + Intergenic
1096158764 12:49359424-49359446 GCAAGGATCTTGGACTTTCTGGG + Intergenic
1098909713 12:76196450-76196472 GCAAGGGTTTTAGGAGCTCTGGG + Intergenic
1101273597 12:103175078-103175100 GCAAGGATATTATATGCTATAGG + Intergenic
1102131293 12:110530936-110530958 GCAAAGATGTTAAAAGCTCTAGG - Intronic
1102789240 12:115630530-115630552 GCCATGATCTTAGCTGCTATAGG - Intergenic
1103741031 12:123091740-123091762 GCCAGGCTCCTATATGCTCTGGG - Intronic
1108925459 13:55736753-55736775 GGAAGGAGTTTAGAAGCTCTTGG - Intergenic
1110770292 13:79335225-79335247 GCTAGAATCTTAGTGGCTCTAGG - Intronic
1113536534 13:111071061-111071083 CCAAAGCTCTTACATGCTCTGGG - Intergenic
1114884914 14:26836752-26836774 GAAAAGAACTTAGCTGCTCTGGG - Intergenic
1115810245 14:37099181-37099203 AAAAGGATTTTATATGCTCTTGG - Intronic
1119168096 14:72512652-72512674 GAGAGGATTTTAGAGGCTCTTGG - Intronic
1120854553 14:89201519-89201541 GCCAGGCTCTGAGGTGCTCTGGG - Intronic
1122646696 14:103199230-103199252 CCAAGGGTTTTAGATGCTCTTGG + Intergenic
1123139790 14:106063819-106063841 GCCAGGATCTTAGGGGCACTGGG + Intergenic
1124589517 15:31040813-31040835 GCTAGGTTCTTAGTTGATCTGGG + Intronic
1129711431 15:77822160-77822182 GCAAGGATGTCAGAGACTCTGGG - Intergenic
1134120017 16:11577209-11577231 GCAAGGATGTCAGATGCACTTGG - Intronic
1136040671 16:27576259-27576281 GAAATGATCTGAAATGCTCTCGG - Intronic
1139992611 16:70952234-70952256 GCAAGCATCTTTTATGCTGTAGG - Intronic
1140018248 16:71209900-71209922 GGAAGGATATTACATGCTCATGG + Intronic
1140261486 16:73384114-73384136 GCCATGATGTCAGATGCTCTTGG + Intergenic
1143384822 17:6522786-6522808 ACAAGGCTCTGAGAGGCTCTGGG - Intronic
1146130510 17:30269961-30269983 ACAGGGATCTTAGATGCTGTGGG + Intronic
1149035134 17:52125409-52125431 GATAGGTTCTTAGATACTCTGGG - Intronic
1150325555 17:64253904-64253926 TCAAGCATCTACGATGCTCTGGG + Intronic
1151403434 17:73871204-73871226 TCAAGGCTCCTAGATGCTGTGGG - Intergenic
1153887759 18:9482277-9482299 CCAAGGATCTTTGAAGTTCTAGG - Intronic
1155287753 18:24308610-24308632 GATAGGCTCTTAGAGGCTCTGGG - Intronic
1157496000 18:48157996-48158018 GCAAACATCCTAGATGCCCTGGG + Intronic
1166535716 19:43573364-43573386 GCAAGGGCCTTAAATGCACTTGG - Intronic
927073580 2:19554395-19554417 TCAACAATCTTAGATTCTCTGGG + Intergenic
928385855 2:30867313-30867335 GGAAAGATCTTTGAAGCTCTCGG - Intergenic
928399449 2:30967333-30967355 CTAAGGATCTTAAATGCTTTAGG - Intronic
930263836 2:49176971-49176993 GAAAGGCTCTGAGATGCTCTAGG - Intergenic
932449969 2:71803204-71803226 GCATGCTTCTGAGATGCTCTTGG - Intergenic
934635237 2:95980907-95980929 ACAAGCATCTTAGGTGCTCAAGG + Intronic
940190624 2:151036867-151036889 CCAAGGGTTTTAGGTGCTCTGGG - Intronic
940690631 2:156914939-156914961 GAAAGGATCACAGTTGCTCTAGG + Intergenic
942134150 2:172908906-172908928 TCAAGGGTCTTAGAAGCACTTGG - Intronic
942308218 2:174629382-174629404 GGAAGGCTATTAAATGCTCTGGG + Intronic
944754877 2:202750644-202750666 ACAAGCATCTTATATGTTCTAGG + Intronic
1169091044 20:2861692-2861714 CCAAGGATACTGGATGCTCTCGG - Exonic
1175198139 20:57260230-57260252 GAAAGGATTTTAGATGATGTAGG + Intronic
1175559910 20:59915164-59915186 GAAAGGATTTTAGATGCTGGAGG - Exonic
1175912030 20:62409598-62409620 GCAAGGAGCTAGGATGTTCTGGG - Intergenic
1177175305 21:17696069-17696091 TCAAGGATCTTACATTATCTGGG - Intergenic
1178074559 21:29002941-29002963 GCAAGGCGCCCAGATGCTCTGGG - Intergenic
1183393567 22:37559765-37559787 GCAAGCCTCCTAGGTGCTCTTGG + Intergenic
1184431693 22:44444895-44444917 GCAAGGAGCTTAGCCTCTCTGGG - Intergenic
955436587 3:58906502-58906524 GAAAGGATCTCATATGCTCAAGG - Intronic
957643053 3:82883983-82884005 GCAAGTACCTTAGCTGCTCCTGG + Intergenic
959643811 3:108673950-108673972 TCAAGGAACCTAGATGCTATTGG + Intronic
960818210 3:121696337-121696359 GCAATTCTCTTAGATGTTCTAGG + Exonic
960930266 3:122840869-122840891 GAAAGGATCTTACATTCTATAGG + Intronic
961368532 3:126415949-126415971 GCAGGGAACCTAGAGGCTCTGGG - Intronic
962941202 3:140126155-140126177 GCAAGGAACTGAGATGCTATGGG + Intronic
968650126 4:1757138-1757160 GCAAGGACCTGCGATGCCCTGGG + Intergenic
969558574 4:7930674-7930696 ACAAGGGTTTTAGAAGCTCTGGG + Intronic
970585126 4:17507900-17507922 ATAAATATCTTAGATGCTCTAGG - Intronic
971303826 4:25463387-25463409 GCAAGGAGCTTATATTCTATTGG + Intergenic
977112718 4:92979401-92979423 GCAAGGACCTTAGATGATTTAGG + Intronic
981907770 4:149942476-149942498 GCAAGGATTTTAGGAGCTCTGGG - Intergenic
986110928 5:4716161-4716183 TCCAGGATCTTAGAAGATCTAGG + Intergenic
991257142 5:64627621-64627643 GCTAGGATTTTGGATGCTTTGGG - Intergenic
999872903 5:155771130-155771152 GCAAGGGACTTAGACTCTCTGGG - Intergenic
1001335782 5:170795532-170795554 GCAAGGATCTAAGAAGCCATGGG - Intronic
1003449681 6:6219186-6219208 GCAAGGATCTCAGGAGCTATTGG - Intronic
1003613047 6:7630434-7630456 GCCATGATCTTCTATGCTCTGGG - Intergenic
1004737544 6:18422632-18422654 TCCAGGATCTTAGATGCTTCTGG - Intronic
1005375487 6:25178124-25178146 GCTAGACTCTAAGATGCTCTGGG - Intergenic
1007083266 6:39123992-39124014 GCATAGCTCTTAGATTCTCTTGG - Intergenic
1007646448 6:43385464-43385486 GCAAGTATCTTACACGCTTTAGG - Intergenic
1011649163 6:89490065-89490087 GCAAGGTGCTTAGATGCCATTGG - Intronic
1013560191 6:111295983-111296005 GTAAGGAGCTTTCATGCTCTAGG - Intergenic
1014464122 6:121734618-121734640 ACAATGATCCGAGATGCTCTTGG - Intergenic
1016704119 6:147087292-147087314 GAAAGGATATCAGATGCTGTTGG + Intergenic
1017592586 6:155993330-155993352 GCAAAGATTTTAGCTGCACTGGG + Intergenic
1018003846 6:159602513-159602535 GGAAGGAGCTTAGATGTTTTTGG - Intergenic
1018069895 6:160155047-160155069 GCAAGGATGATGCATGCTCTTGG + Intronic
1018361676 6:163076935-163076957 GCCAGGACATTAGATGCTGTGGG - Intronic
1022049670 7:26653657-26653679 TCAGGGATCTTGGATGCTTTGGG + Intergenic
1024525701 7:50347353-50347375 ACAGGGATCTCAGAGGCTCTAGG - Intronic
1027224955 7:76237924-76237946 GCAAGGATCCTTGATGCTGGGGG - Intronic
1028728351 7:94115493-94115515 GCAAGGCTCTTAGATAATATGGG + Intergenic
1030876773 7:114823154-114823176 ACAAGGTACTTAGCTGCTCTGGG + Intergenic
1031594782 7:123637485-123637507 GCAACAATGTTAGATGCTGTAGG - Exonic
1033771071 7:144552589-144552611 GCCAGCATGTTAGATGTTCTAGG + Intronic
1034299990 7:150006988-150007010 CCAAGGAGCTAAGATGCTGTTGG - Intergenic
1034806054 7:154090322-154090344 CCAAGGAGCTAAGATGCTGTTGG + Intronic
1035140397 7:156753628-156753650 GCAAGGAACCTGGATGTTCTGGG + Intronic
1037653417 8:20861875-20861897 GCAAGGTTCTTAGATGTGGTAGG + Intergenic
1040558704 8:48504504-48504526 GCAAAGTTCTTTGATCCTCTTGG + Intergenic
1041458114 8:58082005-58082027 CCTAGGCTCTTAGATGCTCAAGG + Intronic
1043591538 8:81839346-81839368 ACTAGAATCTTAAATGCTCTAGG - Intronic
1046342798 8:112880608-112880630 CCAACGACCTTAGATGTTCTGGG - Intronic
1047621162 8:126609385-126609407 GCAAAGATGCTAGAAGCTCTGGG + Intergenic
1048936972 8:139365501-139365523 AGAAGGATCTTAGATGCTGTTGG + Intergenic
1049923883 9:390337-390359 GCATGTGTCTTAGATGTTCTAGG - Intronic
1050057650 9:1672363-1672385 GCAATGAACTGAGATGCACTTGG + Intergenic
1050708641 9:8433914-8433936 GCAAGACTTTTAGTTGCTCTGGG - Intronic
1052433134 9:28392823-28392845 CCAAGGGTTTTAGAAGCTCTAGG + Intronic
1053267416 9:36725260-36725282 GCAAGGGTTTTAATTGCTCTTGG + Intergenic
1061622222 9:131818159-131818181 CCAAGGGTCTTAGAAGCTCTTGG - Intergenic
1186525764 X:10246977-10246999 GCAGGGACCCTAGCTGCTCTGGG + Intergenic
1188180428 X:27048703-27048725 TCAAGGATTTTAGAAACTCTTGG - Intergenic
1191056685 X:56249039-56249061 GCAAGGAGCTCAGATTCTATTGG + Intronic
1194528722 X:95015938-95015960 GCAAAAATCTTAGATGCAATGGG + Intergenic
1197265607 X:124366998-124367020 GAAAGGATCTTAAATGCTTAGGG + Intronic
1198510834 X:137349878-137349900 GCAAGGTTGTTAGGTGCCCTTGG + Intergenic
1199826557 X:151506017-151506039 TCATTCATCTTAGATGCTCTGGG - Intergenic