ID: 922474551

View in Genome Browser
Species Human (GRCh38)
Location 1:225898302-225898324
Sequence GGCAAGGATCTTAGATGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474551_922474556 11 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474556 1:225898336-225898358 ATTGTTAACGAGAGCACTGTAGG No data
922474551_922474557 12 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
922474551_922474563 21 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474563 1:225898346-225898368 AGAGCACTGTAGGGGGGCAGGGG 0: 1
1: 0
2: 1
3: 33
4: 344
922474551_922474559 14 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474559 1:225898339-225898361 GTTAACGAGAGCACTGTAGGGGG No data
922474551_922474558 13 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
922474551_922474562 20 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474562 1:225898345-225898367 GAGAGCACTGTAGGGGGGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 304
922474551_922474561 19 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
922474551_922474564 24 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474564 1:225898349-225898371 GCACTGTAGGGGGGCAGGGGAGG 0: 1
1: 1
2: 2
3: 72
4: 905
922474551_922474560 15 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474551 Original CRISPR GGCAAGGATCTTAGATGCTC TGG (reversed) Intronic
No off target data available for this crispr