ID: 922474554

View in Genome Browser
Species Human (GRCh38)
Location 1:225898323-225898345
Sequence CGTTAACAATCTGCGACCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474554_922474559 -7 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474559 1:225898339-225898361 GTTAACGAGAGCACTGTAGGGGG No data
922474554_922474565 19 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474565 1:225898365-225898387 GGGGAGGAGCAATCCTAGCTAGG 0: 1
1: 0
2: 1
3: 16
4: 117
922474554_922474560 -6 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
922474554_922474561 -2 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
922474554_922474558 -8 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
922474554_922474562 -1 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474562 1:225898345-225898367 GAGAGCACTGTAGGGGGGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 304
922474554_922474557 -9 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
922474554_922474556 -10 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474556 1:225898336-225898358 ATTGTTAACGAGAGCACTGTAGG No data
922474554_922474564 3 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474564 1:225898349-225898371 GCACTGTAGGGGGGCAGGGGAGG 0: 1
1: 1
2: 2
3: 72
4: 905
922474554_922474563 0 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474563 1:225898346-225898368 AGAGCACTGTAGGGGGGCAGGGG 0: 1
1: 0
2: 1
3: 33
4: 344
922474554_922474566 28 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474566 1:225898374-225898396 CAATCCTAGCTAGGTGACCTTGG 0: 1
1: 1
2: 7
3: 59
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474554 Original CRISPR CGTTAACAATCTGCGACCTC GGG (reversed) Intronic
921771224 1:219042170-219042192 AGTTACAAATCTGTGACCTCAGG - Intergenic
922474554 1:225898323-225898345 CGTTAACAATCTGCGACCTCGGG - Intronic
1069351563 10:67532854-67532876 AGTTAAAAATCTGCGAGCTTTGG - Intronic
1074995743 10:118755480-118755502 CGTTTATAACCTGCGACCCCGGG - Intergenic
1078312824 11:10262878-10262900 GGTAAAGAATCTGAGACCTCTGG - Intronic
1117985734 14:61384499-61384521 CCTGACCAATCTGCGACATCAGG - Intronic
1139733441 16:68967448-68967470 CGGTAACAGTCTGCAACCTGGGG + Intronic
1140610965 16:76598537-76598559 CTTTAACCATCTGCGAGCGCAGG + Intronic
1165027326 19:32971376-32971398 CGTTAACAATCTTCTGCCCCAGG - Intronic
932533828 2:72569628-72569650 GGTTGCCAATCTGCAACCTCTGG + Intronic
933408542 2:81894831-81894853 AGTTAAGAAGCTGCAACCTCAGG + Intergenic
942432543 2:175928476-175928498 TGTTAACAGTCTGGGACATCCGG - Exonic
947651002 2:231786323-231786345 CGTTTACAGCCTTCGACCTCCGG - Intronic
978250214 4:106621820-106621842 AGTTAAAAAACTGCAACCTCAGG - Intergenic
983445329 4:167843259-167843281 CTTTAACATTTTGCTACCTCAGG - Intergenic
1011422527 6:87188455-87188477 GGTTAAAAATCTGAGATCTCAGG - Intronic
1060370110 9:123061050-123061072 GGTTAACAAACTACCACCTCAGG + Intronic