ID: 922474555

View in Genome Browser
Species Human (GRCh38)
Location 1:225898324-225898346
Sequence TCGTTAACAATCTGCGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474555_922474564 2 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474564 1:225898349-225898371 GCACTGTAGGGGGGCAGGGGAGG 0: 1
1: 1
2: 2
3: 72
4: 905
922474555_922474557 -10 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
922474555_922474561 -3 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
922474555_922474566 27 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474566 1:225898374-225898396 CAATCCTAGCTAGGTGACCTTGG 0: 1
1: 1
2: 7
3: 59
4: 345
922474555_922474558 -9 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
922474555_922474563 -1 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474563 1:225898346-225898368 AGAGCACTGTAGGGGGGCAGGGG 0: 1
1: 0
2: 1
3: 33
4: 344
922474555_922474562 -2 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474562 1:225898345-225898367 GAGAGCACTGTAGGGGGGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 304
922474555_922474559 -8 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474559 1:225898339-225898361 GTTAACGAGAGCACTGTAGGGGG No data
922474555_922474565 18 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474565 1:225898365-225898387 GGGGAGGAGCAATCCTAGCTAGG 0: 1
1: 0
2: 1
3: 16
4: 117
922474555_922474560 -7 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474555 Original CRISPR TCGTTAACAATCTGCGACCT CGG (reversed) Intronic
908562470 1:65320470-65320492 TCATTTACAAGCTGTGACCTTGG + Intronic
910623899 1:89285742-89285764 TTTTTAACAACCTGCGTCCTTGG + Intergenic
913586250 1:120278178-120278200 ACCTTAACAACCTGTGACCTTGG + Intergenic
913621936 1:120620191-120620213 ACCTTAACAACCTGTGACCTTGG - Intergenic
914568259 1:148890036-148890058 ACCTTAACAACCTGTGACCTTGG + Intronic
914604566 1:149240213-149240235 ACCTTAACAACCTGTGACCTTGG - Intergenic
917958062 1:180120543-180120565 TGGTTAACAATGTGTGCCCTTGG + Intergenic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
1078145959 11:8721966-8721988 TCCTTAACAAGCTGCTTCCTTGG + Intronic
1091135607 11:133186296-133186318 TCCTTAAAAATCTGCAGCCTGGG - Intronic
1113739981 13:112704874-112704896 TCGTGGGCAATCTGAGACCTTGG - Intronic
1133429572 16:5724928-5724950 TCTTTAACAGTCTGCGACTGGGG + Intergenic
1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG + Intronic
1163010119 19:14419715-14419737 TTGCTATCAATCTGCGGCCTGGG + Intergenic
1168620803 19:57877973-57877995 TGGTTAACAATGTGCAACTTCGG + Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946133498 2:217626275-217626297 TCGTTATCAATGTACGACCATGG + Intronic
948460403 2:238127505-238127527 TCCTGAACGATCTGCGAGCTGGG - Intronic
1169627923 20:7593728-7593750 TCATAAACAATCTGCGAATTTGG + Intergenic
983744537 4:171181167-171181189 TGTTTAACAATCTGCAAACTTGG + Intergenic
988483650 5:31650140-31650162 GTGTTAACAATCTGTGTCCTGGG + Intronic
988483683 5:31650489-31650511 GTGTTAACAATCTGTGTCCTGGG - Intronic
999973865 5:156891684-156891706 TTGTTAGCAAACTCCGACCTGGG + Intergenic
1014138916 6:117918711-117918733 CTGTTTAGAATCTGCGACCTTGG + Intronic
1020340558 7:7105096-7105118 CCGTCACCTATCTGCGACCTGGG + Intergenic
1030568464 7:111190629-111190651 TCACTAACAATATGTGACCTTGG + Intronic
1035087509 7:156273308-156273330 TGCTTGACAATCTGCCACCTGGG + Intergenic
1036794424 8:11744986-11745008 TCATTAGCACTCTGAGACCTGGG + Intronic
1038741711 8:30222477-30222499 TTGTTAACATTCTGCCACATTGG + Intergenic
1050609993 9:7342211-7342233 TCTTTTACACTCTGAGACCTGGG + Intergenic
1057349280 9:94281504-94281526 TCGTTGACAATCCTCAACCTTGG - Intronic
1058060293 9:100488373-100488395 ACGTTAACAATCTTGGACATAGG + Intronic