ID: 922474557

View in Genome Browser
Species Human (GRCh38)
Location 1:225898337-225898359
Sequence TTGTTAACGAGAGCACTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474550_922474557 13 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
922474553_922474557 -4 Left 922474553 1:225898318-225898340 CCTTGCCCGAGGTCGCAGATTGT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
922474551_922474557 12 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
922474554_922474557 -9 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
922474555_922474557 -10 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474557 Original CRISPR TTGTTAACGAGAGCACTGTA GGG Intronic
903922568 1:26810948-26810970 TTGTTAACTAGATAACTCTAAGG - Intergenic
908522801 1:64960891-64960913 TTGTTAATCACAGCACAGTATGG - Intronic
908856965 1:68441239-68441261 TAACTAACCAGAGCACTGTATGG - Intronic
913490396 1:119374349-119374371 TTGTCAACAACAGCACTGTCAGG - Intronic
922474557 1:225898337-225898359 TTGTTAACGAGAGCACTGTAGGG + Intronic
1076115255 10:127891127-127891149 TTGTCAAGGAGAGCCCTGAAGGG - Intronic
1078044627 11:7902419-7902441 TTGTTATGGAGAGAAGTGTACGG - Intergenic
1084656216 11:70520616-70520638 TTGCTTTCGAGAGCACTGTGTGG - Intronic
1085834197 11:79934917-79934939 TTGATATCTAGAGCACTGGAGGG - Intergenic
1088977291 11:114827127-114827149 TTGTTAATGAGAGCACAGGAGGG + Intergenic
1089958553 11:122595478-122595500 TTCTTAAGGAGAGTACTGGAAGG + Intergenic
1093486983 12:19663099-19663121 GTGCTAACCAGAGCAGTGTAGGG + Intronic
1103276437 12:119715666-119715688 TTTTTAATGAGCGAACTGTACGG + Intronic
1106647737 13:31654864-31654886 TTGTTAAGGAGAGCCCAATAGGG + Intergenic
1114184061 14:20386871-20386893 TTGTTCATGACAGCACTGTGAGG + Intronic
1119120437 14:72070693-72070715 TTGTTAAAGGGAGCACTGGATGG + Intronic
1126944941 15:53809129-53809151 TTGTTAAAGAGAGGGATGTATGG + Intergenic
1132266799 15:100481079-100481101 GTGTCAAGGAAAGCACTGTAAGG - Intronic
1135960878 16:26993558-26993580 TTGGTACCTAGAGCAATGTATGG - Intergenic
1141239640 16:82253823-82253845 TTGTGAAAGAAAGGACTGTATGG + Intergenic
1149252081 17:54781762-54781784 TTGTGAACAACAGCAGTGTATGG + Intergenic
1162258314 19:9511326-9511348 TTGTTATGGAGAGGAGTGTACGG - Intergenic
1164073436 19:21790711-21790733 TTGTTACAGAGAGGAGTGTATGG - Intergenic
1167808561 19:51808289-51808311 TTGTTACAGAGAGAAGTGTATGG - Intronic
1167875756 19:52410964-52410986 TTGTTACGGAGAGGAGTGTACGG - Intronic
927005163 2:18840998-18841020 TGGTTAACAAGAACACTGGAAGG + Intergenic
930593002 2:53352502-53352524 TTGTTTTCTATAGCACTGTACGG - Intergenic
932096620 2:68855688-68855710 TTATTATCGAAAGCACTGTCTGG + Intergenic
933058825 2:77709441-77709463 TAGTTAACGACAACACTGAAGGG - Intergenic
940911228 2:159211775-159211797 TTGTAAACGAGAGCCTTGTCAGG + Intronic
947309305 2:228782980-228783002 TTGTTTAGTAAAGCACTGTATGG + Intergenic
1182733682 22:32515193-32515215 TTTTTAGCTAGAACACTGTAAGG + Intronic
1183290335 22:36998213-36998235 TTGTTAAAGAGAGAACTGGAAGG + Intronic
954944407 3:54407050-54407072 TTGTAAACAAGAGCAGTGGAAGG + Intronic
955690211 3:61583324-61583346 TAGTTTACAAGACCACTGTAAGG - Intronic
966439304 3:179926250-179926272 TTGTTAAGGAGAGCACTGTGGGG - Intronic
970564578 4:17318937-17318959 TAGTGTACTAGAGCACTGTAGGG + Intergenic
979972987 4:127160647-127160669 TTGTTAACGGGAGCATTAGATGG + Intergenic
986083942 5:4424087-4424109 ATATTAACACGAGCACTGTATGG - Intergenic
996691922 5:126349316-126349338 TTGTTAAGGAAAGCATTGTTAGG - Intergenic
998085183 5:139315765-139315787 TTGTAAAGGAGATCAATGTAAGG + Intronic
999519536 5:152336854-152336876 TTTTTAAAAAGAGCAATGTAAGG - Intergenic
1008278807 6:49571712-49571734 TTCTTAAAGAGGCCACTGTAGGG - Intergenic
1011979139 6:93350332-93350354 TTTTTAAAGATAGCACTCTATGG + Intronic
1012898004 6:104973893-104973915 TTCTTAACAAGAGCATTGGATGG + Intronic
1020353907 7:7256066-7256088 TAGTTAACTAGATCTCTGTATGG + Intergenic
1023471218 7:40522462-40522484 TTGTTAACCAGGTAACTGTAAGG - Intronic
1040776826 8:51054750-51054772 TTTCTAATGAGAGCACTGAAAGG - Intergenic
1055122413 9:72677096-72677118 TTGTTAGCCAGGGCACTCTAGGG + Intronic
1188834422 X:34939097-34939119 TGGTTAACGAGAGGACTGCCAGG + Intergenic
1192759930 X:74086336-74086358 TTCTTAGCGAGATCAATGTAGGG - Intergenic
1197891424 X:131274178-131274200 TTGCTCAGGAGTGCACTGTAGGG - Exonic
1198315921 X:135466084-135466106 TTGAAAACGAGTTCACTGTAGGG - Intergenic