ID: 922474558

View in Genome Browser
Species Human (GRCh38)
Location 1:225898338-225898360
Sequence TGTTAACGAGAGCACTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474553_922474558 -3 Left 922474553 1:225898318-225898340 CCTTGCCCGAGGTCGCAGATTGT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
922474554_922474558 -8 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
922474555_922474558 -9 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
922474550_922474558 14 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
922474551_922474558 13 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474558 Original CRISPR TGTTAACGAGAGCACTGTAG GGG Intronic
901598213 1:10401684-10401706 TGTTAACTGGAGCCTTGTAGGGG + Intronic
905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG + Intronic
907893091 1:58654625-58654647 TGTTATATAGAACACTGTAGGGG - Intergenic
916632216 1:166628590-166628612 TTTTGAAGACAGCACTGTAGAGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
1067164579 10:43855218-43855240 TCTTAACAAGAACCCTGTAGAGG - Intergenic
1070686797 10:78490885-78490907 TCTTGAGGAGAGGACTGTAGTGG + Intergenic
1070790433 10:79186067-79186089 TGTTTTTGAGGGCACTGTAGAGG + Intronic
1076115254 10:127891126-127891148 TGTCAAGGAGAGCCCTGAAGGGG - Intronic
1084995363 11:72972109-72972131 TATTAACGAGAGTATTGTATAGG - Intronic
1087533443 11:99413201-99413223 TGTTAAAGAGAGCAAGGAAGAGG + Intronic
1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG + Exonic
1106647738 13:31654865-31654887 TGTTAAGGAGAGCCCAATAGGGG + Intergenic
1106751241 13:32770539-32770561 TGTCAAGGAGAGCACAGCAGAGG + Exonic
1111384498 13:87506724-87506746 TGTTGACGATAGCACTGACGTGG + Intergenic
1113228474 13:108184998-108185020 TGTAAATGAGGTCACTGTAGAGG - Intergenic
1120308892 14:82805244-82805266 CGTCAAAGAGAGCTCTGTAGGGG - Intergenic
1141624666 16:85254924-85254946 TGTTTATGAGCGCACTGTGGTGG - Intergenic
1149387574 17:56157083-56157105 TTTTGAGGAGAGCACTGTACTGG + Intronic
1153331795 18:3881347-3881369 TGTTAAAGATAGAACTGGAGAGG + Intronic
1153978905 18:10292754-10292776 TGATAACGGGACCACTGGAGAGG - Intergenic
1159797831 18:72866718-72866740 TGGTAACGCGGGCAGTGTAGAGG - Intronic
1165239339 19:34451910-34451932 TGTTAAACAGAGCACAGTAGAGG + Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935649749 2:105372129-105372151 TATTAACCAGAGAAATGTAGTGG + Intronic
938890765 2:135702949-135702971 TGTTAGAGACAGCACTTTAGTGG - Intronic
940185430 2:150979677-150979699 TGTTAACCAAAGCACTTTTGGGG - Intergenic
940286144 2:152034736-152034758 TGTTTAAAAGAGCACTGTGGGGG - Intronic
943522179 2:188966059-188966081 AGTTAACTACAGCAATGTAGTGG + Intergenic
1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG + Intronic
961325806 3:126108602-126108624 TGGTCACGAGAGCTCTGTTGAGG + Intronic
964573321 3:158136431-158136453 TGCAAACTAGAGCTCTGTAGGGG - Intronic
968931272 4:3580818-3580840 TGATCACCAGATCACTGTAGGGG - Intronic
981932654 4:150207876-150207898 TGGTATAGAGACCACTGTAGTGG + Intronic
984577378 4:181466660-181466682 TGTAAACTAGATAACTGTAGAGG - Intergenic
985070167 4:186159765-186159787 TGTTCACGCGAGGCCTGTAGTGG + Intronic
989271554 5:39539564-39539586 TGATAATGAGAAAACTGTAGTGG + Intergenic
1004080518 6:12387791-12387813 TGGTAAAGAGTGCACTGTATAGG + Intergenic
1011224248 6:85089382-85089404 TGTTAAGGAGTGCAGTGGAGGGG + Intergenic
1016354897 6:143208064-143208086 TGCTAAGGAATGCACTGTAGAGG + Intronic
1016690050 6:146927277-146927299 TGTTCACTAGAGAAATGTAGAGG - Intergenic
1022589641 7:31649530-31649552 TGTTAACAAGAATACTTTAGAGG - Intronic
1024602874 7:51000290-51000312 TGAAAACCAGAGCTCTGTAGAGG - Intergenic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1028752716 7:94399384-94399406 TGTTAAAAAGAGGACTGTGGTGG - Intronic
1029696280 7:102215498-102215520 TGATAACGTGAGCACCGAAGCGG + Intronic
1046037011 8:108854655-108854677 TCTTAACCAGAGCTCTGAAGTGG - Intergenic
1055122414 9:72677097-72677119 TGTTAGCCAGGGCACTCTAGGGG + Intronic
1058869894 9:109192447-109192469 TGCTAATGAGATCAGTGTAGAGG - Intronic
1186384870 X:9099756-9099778 CGTTAACGAGAACCCTGTAGTGG + Intronic
1187731867 X:22263812-22263834 TGGCTACCAGAGCACTGTAGTGG - Intergenic
1198315920 X:135466083-135466105 TGAAAACGAGTTCACTGTAGGGG - Intergenic