ID: 922474560

View in Genome Browser
Species Human (GRCh38)
Location 1:225898340-225898362
Sequence TTAACGAGAGCACTGTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474551_922474560 15 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
922474553_922474560 -1 Left 922474553 1:225898318-225898340 CCTTGCCCGAGGTCGCAGATTGT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
922474550_922474560 16 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
922474555_922474560 -7 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
922474554_922474560 -6 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474560 Original CRISPR TTAACGAGAGCACTGTAGGG GGG Intronic
904079126 1:27861016-27861038 TAAACGATACCACCGTAGGGTGG - Intergenic
906669206 1:47642676-47642698 TGAACGAGGGCATTGTAGTGAGG + Intergenic
921069837 1:211649678-211649700 TGAACAGGAGCACTGCAGGGAGG - Intergenic
922474560 1:225898340-225898362 TTAACGAGAGCACTGTAGGGGGG + Intronic
922859542 1:228804491-228804513 GTAAGGAGAGCAGTGGAGGGTGG + Intergenic
1063198133 10:3762126-3762148 TGAAAGAGAGCACTGAAGGCTGG - Intergenic
1080332498 11:31155371-31155393 TTTAAGAAAGTACTGTAGGGGGG + Intronic
1087596985 11:100266650-100266672 TTAAAGAGAGGAATGAAGGGTGG + Intronic
1091200558 11:133777188-133777210 TCAACTAGAGAACAGTAGGGAGG - Intergenic
1106942645 13:34794884-34794906 TTAATGAGAGAACAGTATGGGGG - Intergenic
1109195485 13:59373554-59373576 TTAACAACAGCCCTGGAGGGTGG + Intergenic
1111594599 13:90395589-90395611 TTAAAGAGAACACTGTCAGGAGG + Intergenic
1119740765 14:77012404-77012426 TGAGCGTGAGCACTGTGGGGAGG - Intergenic
1122494300 14:102140600-102140622 TTAACAAGATCTCTGTAAGGCGG + Intronic
1130611377 15:85364307-85364329 GTCACTATAGCACTGTAGGGAGG - Intergenic
1140512651 16:75519252-75519274 TTAACGGGATCTCTGAAGGGAGG - Intergenic
1141540409 16:84716014-84716036 TCAACCAGAGCACTGTGGCGAGG + Intronic
1148772113 17:50073412-50073434 TTCACGAGAGTGCTGTGGGGTGG - Intronic
1149932396 17:60769332-60769354 TTAGTGGGAGCAGTGTAGGGAGG + Intronic
1150626149 17:66842343-66842365 ATAATGAGAGCACTGTCAGGAGG + Intronic
1164730100 19:30497061-30497083 TTAAGGAGAGCAAAGTAGAGGGG - Intronic
925938167 2:8788002-8788024 TTGAAGAGAGCACTGGATGGAGG - Intronic
930385422 2:50688383-50688405 ATAAGGAGGGCTCTGTAGGGAGG - Intronic
931546897 2:63398229-63398251 TTAAGGAGAGCAGTGAAGGTTGG + Intronic
936985065 2:118301598-118301620 TTGATGAGAGCAATGTAAGGTGG - Intergenic
937630039 2:124091256-124091278 TAAAAGAGAGCAATTTAGGGTGG + Intronic
1176662894 21:9656535-9656557 TAAAGGAGAGAACTGTTGGGTGG - Intergenic
1178179186 21:30140357-30140379 TTAACGTGAGGACTTTAGGAGGG + Intergenic
1183707700 22:39484688-39484710 TTAAGGACAGCAAGGTAGGGTGG - Intronic
1185165632 22:49260689-49260711 GTAACGAGGACACTGAAGGGAGG + Intergenic
955635839 3:61028666-61028688 TGACCCAGAGCACTGTAGTGAGG + Intronic
959825614 3:110792441-110792463 TTAAAGTGACTACTGTAGGGGGG - Intergenic
970571912 4:17391791-17391813 TTAAAGTGAGCTCAGTAGGGTGG + Intergenic
985412427 4:189699515-189699537 TAAAGGAGAGAACTGTTGGGTGG + Intergenic
986495413 5:8336902-8336924 TTAAGGAGAGCACTGCATTGAGG - Intergenic
991432133 5:66559293-66559315 ATAACGGGAGCAGTGCAGGGGGG + Intergenic
991511899 5:67387307-67387329 CTATGTAGAGCACTGTAGGGAGG + Intergenic
993927669 5:93890886-93890908 TTAACCAGAGGAGTGTAGGTAGG - Intronic
999222842 5:149995742-149995764 TAAAGGAGACCACTGTAGAGGGG - Exonic
1005095348 6:22108878-22108900 TTAATGAAAGCACAGTATGGGGG - Intergenic
1015562526 6:134531819-134531841 GAAACAACAGCACTGTAGGGTGG + Intergenic
1019880664 7:3857736-3857758 TTAATGAGAGTTCTGAAGGGTGG + Intronic
1031920704 7:127598667-127598689 TTAAAAAGAGCACTGAAGGCCGG + Intronic
1035888346 8:3317654-3317676 TTAACCAGATAACTGTAGGCTGG - Intronic
1041183251 8:55270903-55270925 TTAACCAGAGCCCTGCAGGCAGG - Intronic
1041895822 8:62923825-62923847 TCAACCAGAGCACTGTAGCTGGG - Intronic
1043174776 8:77011487-77011509 TTAAAGAGAGCTCTGCAGGCTGG - Intergenic
1051340289 9:16104189-16104211 TTTCTGAGAGGACTGTAGGGAGG - Intergenic
1056769537 9:89466874-89466896 GTAACAAGACCACTGTGGGGAGG - Intronic
1203670166 Un_KI270755v1:3465-3487 TAAAGGAGAGAACTGTTGGGTGG - Intergenic
1192759929 X:74086333-74086355 TTAGCGAGATCAATGTAGGGAGG - Intergenic
1197261552 X:124324910-124324932 TTAGCCAGAGCACAGAAGGGTGG + Intronic