ID: 922474561

View in Genome Browser
Species Human (GRCh38)
Location 1:225898344-225898366
Sequence CGAGAGCACTGTAGGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474553_922474561 3 Left 922474553 1:225898318-225898340 CCTTGCCCGAGGTCGCAGATTGT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
922474551_922474561 19 Left 922474551 1:225898302-225898324 CCAGAGCATCTAAGATCCTTGCC No data
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
922474555_922474561 -3 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
922474554_922474561 -2 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
922474550_922474561 20 Left 922474550 1:225898301-225898323 CCCAGAGCATCTAAGATCCTTGC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474561 Original CRISPR CGAGAGCACTGTAGGGGGGC AGG Intronic
900801245 1:4738458-4738480 AGAGAGCACTCTAGGCGGGAGGG + Intronic
901239249 1:7683472-7683494 CGGGAGCTCTTTAGGGGAGCTGG + Intronic
902727195 1:18344993-18345015 CCAGAGCACTGAAGGGGAGGAGG + Intronic
903969077 1:27107416-27107438 GTAGTGCATTGTAGGGGGGCTGG - Intronic
906669207 1:47642680-47642702 CGAGGGCATTGTAGTGAGGCTGG + Intergenic
908260565 1:62336843-62336865 CGAGGGCACTGTAGAGCGGGTGG + Intergenic
922474561 1:225898344-225898366 CGAGAGCACTGTAGGGGGGCAGG + Intronic
1063953752 10:11247390-11247412 TGCGAGCACTGAAGGGGGGCCGG - Intronic
1064177120 10:13084834-13084856 GGAGAGCACAGTATGGGTGCAGG + Intronic
1069789362 10:71009903-71009925 CCAGAGCACTGGACTGGGGCAGG - Intergenic
1069797522 10:71062876-71062898 CCAGGGAACTGCAGGGGGGCCGG - Intergenic
1070149926 10:73799352-73799374 GTAGAGCAGTGTAGGGGTGCAGG - Exonic
1073078517 10:100840027-100840049 CAAGAGCACTGAAAGGGGTCAGG - Intergenic
1075722845 10:124597568-124597590 CCAGAGCACTGTGGGAGGACTGG + Intronic
1076303491 10:129446561-129446583 CCAGACCACTGTGAGGGGGCAGG - Intergenic
1076381475 10:130027189-130027211 GGAGAGCCCTGAAGTGGGGCAGG - Intergenic
1076797291 10:132804281-132804303 CGAGAGCCCTGTGAGGGGACAGG - Intergenic
1076850603 10:133090694-133090716 CCAGAGCACAGCAGTGGGGCAGG - Intronic
1077189906 11:1251588-1251610 GGGGAGCACTGCAGGGGTGCGGG - Exonic
1081295351 11:41379923-41379945 AGGGAGCACTGTAGGGTGACTGG - Intronic
1081725156 11:45322766-45322788 AGAGAGAACTGAAGGGGGTCTGG - Intergenic
1084711008 11:70843730-70843752 AGAGAGCCCTGCAGGTGGGCTGG - Intronic
1095160214 12:38906171-38906193 CGAGGGCACAGTAGGAGGGACGG - Intronic
1097119649 12:56721357-56721379 AGAGGGCACTGTTGTGGGGCAGG + Exonic
1098205817 12:68108826-68108848 GGAGGGCACTGTAGGAGGTCAGG - Intergenic
1098897688 12:76083134-76083156 GGATGGCAGTGTAGGGGGGCTGG - Intronic
1101904088 12:108812484-108812506 AGAGAGCACAGGACGGGGGCAGG + Intronic
1103550334 12:121732444-121732466 CGAGAGAATTGCAGGGGAGCAGG + Intronic
1104719743 12:131038698-131038720 CGAGAGCACAGCCGGGGTGCAGG + Intronic
1105900334 13:24747073-24747095 AGAGTGCGCTGAAGGGGGGCGGG - Intergenic
1113677288 13:112215416-112215438 GGAGAGAGCTGAAGGGGGGCAGG + Intergenic
1114553626 14:23548845-23548867 CGAGAGCACTGCGGGGGCGCCGG - Intronic
1122226802 14:100285300-100285322 CTGGAGCACTGCAGGGTGGCAGG - Intergenic
1124003723 15:25780095-25780117 CGAGGGCACTGTAGGGAGTGGGG - Intronic
1128158766 15:65409391-65409413 GGAGAGGACTGCAGGGTGGCTGG + Intronic
1128158888 15:65410154-65410176 TGAGTGCCCTGTAGGGGAGCGGG - Intronic
1129087770 15:73114251-73114273 GGAGAGCAATGCAGGGGAGCTGG + Intronic
1129698172 15:77752480-77752502 CCAGAGCCCTGTGGGGAGGCTGG - Intronic
1132299282 15:100766402-100766424 TGAGACCACTGGAGGGGGGTGGG + Intergenic
1132543915 16:524412-524434 CGAGAGCAGGGTGGGGTGGCCGG + Intergenic
1133285773 16:4690058-4690080 AGAGAGAACTGCAAGGGGGCCGG - Exonic
1137361357 16:47818984-47819006 AGAGAGTACGGTAGGGGGGAGGG - Intergenic
1138561553 16:57803521-57803543 GGAGAGGACTGGAGGGGGTCGGG + Intronic
1139265534 16:65635255-65635277 CTAGAGCACTGCAGGGAGGCTGG - Intergenic
1139587928 16:67916314-67916336 GGAGAGCACTCTATGGGGTCAGG - Intronic
1142306073 16:89286414-89286436 GGAGAGCACAGGAGGGGTGCGGG - Intronic
1143972595 17:10806249-10806271 CTGGAGCCCTGGAGGGGGGCAGG + Intergenic
1147184331 17:38705410-38705432 CGAGAGCACGGCGGGGGGGGCGG + Intergenic
1148160391 17:45446498-45446520 CGAGATCACTGCAGGGGAGGGGG - Intronic
1151346996 17:73508293-73508315 CGAGAGAACCGTGGCGGGGCAGG - Intronic
1152395281 17:80029213-80029235 CGAGAGCGCTTTGAGGGGGCTGG + Intronic
1152812031 17:82386682-82386704 CGAGAGCACGGGAAGGGGGCTGG + Intergenic
1157583348 18:48786151-48786173 AGAGAGCACTGCAGGGAGACAGG + Intronic
1163841807 19:19615990-19616012 CTAGAGCCCTGTAGTGGGGAGGG - Intronic
1164466290 19:28490152-28490174 GGAGAGAACTGTGGTGGGGCTGG - Intergenic
926107407 2:10160876-10160898 TGGGAGCACTGCAGGGGCGCAGG - Intronic
927152037 2:20201793-20201815 AGAGAGGACTGTAGGGAGGGCGG - Exonic
935191117 2:100779592-100779614 GCTGAGCACTGGAGGGGGGCGGG - Intergenic
936403697 2:112184434-112184456 CGTGAGCACTGTGGGAGGGAGGG - Intronic
937086598 2:119175915-119175937 CGAGGGCACTGATGGGGGTCAGG + Intergenic
944252482 2:197591734-197591756 CGAGGGCAGTGTGGGAGGGCTGG + Intronic
945907882 2:215615062-215615084 CGAGAGCAGCGTGGGCGGGCCGG + Intergenic
947312944 2:228823955-228823977 TGAGAGCACTGCAGTGGGGAGGG + Intergenic
1169138931 20:3215480-3215502 AGAGAGCACTGTGTGGGGGAGGG + Intronic
1175224823 20:57439103-57439125 GGAGAGCAGGGCAGGGGGGCGGG - Intergenic
1175237749 20:57525683-57525705 GGATAGCCCTGCAGGGGGGCTGG + Intergenic
1175237814 20:57525855-57525877 GGAGAGCCCTGCAGGGGGGCGGG + Intergenic
1181440744 22:22934116-22934138 CCAGAGCTCTGCAGAGGGGCAGG + Intergenic
1181545332 22:23599222-23599244 CCAGAGCCCTGCAGAGGGGCAGG - Intergenic
1181814977 22:25430678-25430700 CCAGAGCTCTGCAGAGGGGCAGG + Intergenic
1182387456 22:29957117-29957139 AGAGAGTATTGGAGGGGGGCGGG - Intronic
1183743764 22:39681888-39681910 GGAGAGCAGTGTAGGGGTGCGGG - Intronic
1184587165 22:45455764-45455786 AGAGAGCCCTGCATGGGGGCGGG - Intergenic
1185165633 22:49260693-49260715 CGAGGACACTGAAGGGAGGCAGG + Intergenic
951915606 3:27797930-27797952 CGGGAGCACTGTGCGGCGGCAGG - Intergenic
953352196 3:42223733-42223755 GGTGAGGACTGGAGGGGGGCCGG + Exonic
953691161 3:45120888-45120910 GGGGAGCACTTTAGGTGGGCTGG - Intronic
953980731 3:47411711-47411733 CGAGGGCAGTGTGGGGTGGCAGG + Intronic
960962634 3:123083031-123083053 CAAGAGCACGGCAGGGGGTCTGG + Intronic
962816696 3:139006574-139006596 GCAGAGCACTGTCGGGAGGCGGG - Intronic
964063437 3:152553558-152553580 TGACAGCACTGTAGGCAGGCTGG - Intergenic
968956024 4:3720048-3720070 CGACAGCACTGCAGGGGCGCAGG - Intergenic
972581134 4:40396636-40396658 CAGGAGCACTGTAGAGGGGCCGG + Intergenic
984591916 4:181626549-181626571 TGAGAGCACAGCAAGGGGGCGGG + Intergenic
986327378 5:6686260-6686282 CGGGACCACTGTAAGGGGTCTGG + Intergenic
998402322 5:141854173-141854195 AGAAGGCACTGTAGGAGGGCAGG + Exonic
1001734653 5:173988775-173988797 CCAGACCACTGCTGGGGGGCTGG - Intronic
1002098366 5:176845227-176845249 CGAGGGCTCTGTCGTGGGGCTGG - Intronic
1003149605 6:3537619-3537641 AGAAAGCACTGTGGGGGAGCTGG - Intergenic
1003824924 6:9942360-9942382 CGAGTGCAGTGTTGGTGGGCCGG - Intronic
1006109612 6:31736569-31736591 GGAGGGGACTGGAGGGGGGCGGG + Intronic
1016069877 6:139726523-139726545 CGAGAGCAGTGCCGGTGGGCTGG + Intergenic
1018512743 6:164543537-164543559 CGTGAGCACTGCAGGTAGGCTGG + Intergenic
1019430373 7:996339-996361 CAGGAGCTCTGTTGGGGGGCGGG + Intergenic
1022937041 7:35188664-35188686 CGAGTGCACTATAGGATGGCCGG - Intergenic
1023849508 7:44142208-44142230 CGAGGGCACAGCAGAGGGGCTGG + Intergenic
1026529229 7:71183006-71183028 CCAGAGCACTGCAGGGCTGCTGG + Intronic
1026841337 7:73671323-73671345 CGAGGGCTCAGCAGGGGGGCCGG - Exonic
1027059406 7:75073649-75073671 CGAGGGCACTGGACGGCGGCCGG - Exonic
1028373084 7:90116912-90116934 CGAGTGCACTATAGGATGGCCGG + Intergenic
1029279072 7:99425170-99425192 GGAGACCACTGTAGGGGGAACGG + Exonic
1030138774 7:106284756-106284778 CGAGCGCGCGGCAGGGGGGCGGG - Intronic
1034412052 7:150946963-150946985 TCACAGCACTGTAGGCGGGCGGG + Exonic
1038829588 8:31042239-31042261 CAAGATCACTGGAGGAGGGCTGG + Intronic
1044839843 8:96328210-96328232 CGAGAGGGCTGTGGGGAGGCGGG - Intronic
1045189735 8:99871025-99871047 CAAGAGCACTGTAGAGGGACAGG + Intronic
1046195083 8:110851971-110851993 CGAGAGGACTAAAGGGAGGCTGG + Intergenic
1048600721 8:135916296-135916318 CGAGAGCCCTTTCGGGGGGCGGG - Intergenic
1048972585 8:139653578-139653600 TGTGAGCCCTGTAGGGGAGCAGG + Intronic
1057723747 9:97554089-97554111 AGAGAGCACAGTAGGTGGGGAGG - Intronic
1061361287 9:130143960-130143982 AGAGAGCTCTGAAGGGGGACGGG - Intergenic
1061990490 9:134156130-134156152 CGAGACCAGTGTGGGTGGGCGGG - Intronic
1062189985 9:135242988-135243010 AGACAGCACTGTAGAAGGGCGGG + Intergenic
1062529818 9:136994908-136994930 CGTGAGCACGGAAGGTGGGCGGG - Exonic
1186877175 X:13828038-13828060 CATGAGCACTGTAGGAGGGGTGG - Intronic
1192273672 X:69608771-69608793 GGAGAGCACTGTGGGCAGGCAGG + Intergenic
1195054807 X:101134002-101134024 AGAGAGAGCTGTAGGGGGACTGG + Intronic
1198503925 X:137282087-137282109 TGCGGGCAGTGTAGGGGGGCAGG + Intergenic
1198649252 X:138843102-138843124 CTGGAGCACTGTAGGGGCACAGG + Intronic