ID: 922474565

View in Genome Browser
Species Human (GRCh38)
Location 1:225898365-225898387
Sequence GGGGAGGAGCAATCCTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922474555_922474565 18 Left 922474555 1:225898324-225898346 CCGAGGTCGCAGATTGTTAACGA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 922474565 1:225898365-225898387 GGGGAGGAGCAATCCTAGCTAGG 0: 1
1: 0
2: 1
3: 16
4: 117
922474554_922474565 19 Left 922474554 1:225898323-225898345 CCCGAGGTCGCAGATTGTTAACG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 922474565 1:225898365-225898387 GGGGAGGAGCAATCCTAGCTAGG 0: 1
1: 0
2: 1
3: 16
4: 117
922474553_922474565 24 Left 922474553 1:225898318-225898340 CCTTGCCCGAGGTCGCAGATTGT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 922474565 1:225898365-225898387 GGGGAGGAGCAATCCTAGCTAGG 0: 1
1: 0
2: 1
3: 16
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922474565 Original CRISPR GGGGAGGAGCAATCCTAGCT AGG Intronic
900389625 1:2428287-2428309 GGGGAGCAGCAGGCCTCGCTGGG + Intronic
902387826 1:16085820-16085842 GGGGAGGAGCAGTCCTTCCTTGG - Intergenic
902525462 1:17054320-17054342 GGGGCGGAGCCATCCTATCCGGG + Intergenic
902814034 1:18905937-18905959 GGGCAGCACCAGTCCTAGCTGGG - Exonic
904564670 1:31421547-31421569 GGCGAGGAGCATTTCTAGTTTGG + Intronic
904592688 1:31623795-31623817 GGGAAGGAGCTCTCCTTGCTTGG + Intronic
905482015 1:38268267-38268289 GAGGAGGTGGCATCCTAGCTGGG + Intergenic
908527468 1:65001788-65001810 GGGTAGCAGGAACCCTAGCTTGG + Intergenic
914762641 1:150611511-150611533 GGTGAGTAGCAATTCTTGCTAGG - Intronic
915269624 1:154744481-154744503 GGGCAGGAACCATTCTAGCTTGG + Intronic
917761026 1:178157960-178157982 GATGAAGAGCAATCCTAGCAAGG - Intronic
919776138 1:201195092-201195114 GGGGAGGAGGAATCACAACTAGG - Intronic
919791330 1:201292655-201292677 GGGGAGGAGCTACCTTGGCTGGG + Intronic
920344093 1:205294745-205294767 GGGGATGAGTCATCCTAGGTGGG - Intergenic
922174991 1:223189825-223189847 GGGAAGGAGCTGTCCTGGCTGGG + Intergenic
922474565 1:225898365-225898387 GGGGAGGAGCAATCCTAGCTAGG + Intronic
1067773972 10:49148296-49148318 GGGCAGGAGAAATACTGGCTTGG - Intergenic
1073229235 10:101953468-101953490 CGGGAGGATCAAGACTAGCTTGG - Intronic
1073616941 10:105005537-105005559 GGGGAGGAGGAATAATAGCAGGG + Intronic
1073758183 10:106603478-106603500 GGGGAGCAGCGATGCTGGCTTGG - Intronic
1075388256 10:122073311-122073333 GGGAAGGAGACATCCTACCTTGG + Intronic
1077279975 11:1739616-1739638 TGGGAGGTGCAAGTCTAGCTTGG + Intronic
1078001686 11:7501618-7501640 GGGTGGGAGCAACCCTAGCTGGG - Intronic
1080473238 11:32566424-32566446 GGGGAGAAACAATACTAGATAGG + Intergenic
1083613449 11:64015185-64015207 GGGGAGGAGCAGACCCAGCAGGG + Intronic
1084196751 11:67527129-67527151 GTGGAGGAGAAAGCCTGGCTTGG + Intergenic
1088054461 11:105558300-105558322 GGGGAAGAGGGATTCTAGCTTGG - Intergenic
1089331835 11:117694728-117694750 GGGAAGGAGCCATCCTGGTTGGG + Intronic
1091080774 11:132665578-132665600 GAGGAGGAGAATTCCTATCTTGG + Intronic
1092080244 12:5710020-5710042 GGAGAGGAGAAATGCTAGCCAGG + Intronic
1093824385 12:23665472-23665494 AGGGAGGAGGAATCCTTGCTGGG + Exonic
1095969817 12:47894044-47894066 GGGGAAGGGGAATCATAGCTTGG - Intronic
1100657562 12:96662770-96662792 GGGGAGCAGCACTCCAAGCAGGG - Intronic
1109155593 13:58905926-58905948 GTGGATGAGGAATCCTAGGTAGG + Intergenic
1110937417 13:81308184-81308206 GGAAAGGAGGAATTCTAGCTGGG - Intergenic
1112285001 13:98096348-98096370 GGGGAGGGGAAAGCCCAGCTTGG + Intergenic
1115409866 14:33061917-33061939 GAGGAGGAGCTATCTGAGCTTGG + Intronic
1119454997 14:74747275-74747297 GGGGAAGAGCAATGCTACCTTGG - Intergenic
1120177408 14:81309694-81309716 GGGGAGGAGCTATCCTAAAGAGG + Intronic
1120928481 14:89822470-89822492 TGGGAGGACCAATCCAACCTAGG - Intronic
1121248633 14:92483253-92483275 GGGGAGGAGCATTCCTGGGCAGG - Intronic
1126499769 15:49332541-49332563 GGGGAGAAGCAATGGTAGCTAGG + Intronic
1126749760 15:51864784-51864806 GGGGAGGGGAAATACTGGCTTGG + Intronic
1131866559 15:96717479-96717501 GGGCAGGAGCAGCCTTAGCTTGG - Intergenic
1132948721 16:2547966-2547988 GGGGAGGAGCTCTCCTGGCTGGG + Intronic
1132965866 16:2654161-2654183 GGGGAGGAGCTCTCCTGGCTGGG - Intergenic
1133122018 16:3614609-3614631 GGGCAGGAGAAATACTGGCTTGG + Intronic
1133643866 16:7744566-7744588 GGGGAGGAACAAACCCAGCCAGG + Intergenic
1134909855 16:18015530-18015552 GGGGAGGAGAAGCCCTTGCTTGG - Intergenic
1137514111 16:49127694-49127716 GTGGAGGAGCAATTTTAGATAGG - Intergenic
1139269011 16:65664520-65664542 GGGGAGGAGCAATACCACCGTGG - Intergenic
1139640923 16:68290786-68290808 GGGGAGCAGCAGGCCCAGCTGGG + Intronic
1142297294 16:89233869-89233891 AGGGAGGAGAAATACTGGCTTGG - Exonic
1146257069 17:31397749-31397771 CGGGAGGACGAGTCCTAGCTGGG + Intronic
1154494378 18:14944982-14945004 CTGGAGGAGCAATCCGAGCCTGG - Intergenic
1156699426 18:39807523-39807545 CAGGAGAAGCAATCCTAGCTGGG + Intergenic
1157330529 18:46700703-46700725 GGTGAGCAGCCATCCTAGCTGGG - Intronic
1159842623 18:73417140-73417162 GGGGAGGAATGAACCTAGCTGGG - Intergenic
1159900298 18:74038879-74038901 GGGCAGGAGAAATGCTGGCTGGG + Intergenic
1160272377 18:77398849-77398871 GGGGAAGAGCAAGTCCAGCTGGG - Intergenic
1160521868 18:79512463-79512485 GAGGAGAAGCAACCCTGGCTAGG + Intronic
1160703478 19:518661-518683 GGGGAGGAGAGGCCCTAGCTGGG + Intronic
1160969203 19:1759965-1759987 GGGGAGGAGCAGCCCTAGCTAGG + Intronic
1162179179 19:8855646-8855668 GTGGAGGAGCAATACCATCTAGG + Intronic
1162572281 19:11480490-11480512 GGGTAGGACCAGGCCTAGCTAGG - Intronic
1163552671 19:17974286-17974308 GGGGAGGACCACGCCTACCTTGG - Exonic
926045427 2:9706325-9706347 AGGGAGGAGGAATCCAAGCTGGG + Intergenic
927204392 2:20597970-20597992 GAGGAGGGACAATCCTGGCTGGG + Intronic
931923691 2:67047953-67047975 TGGAAGGAGCAGTCCTGGCTGGG - Intergenic
937651634 2:124325862-124325884 GGGGATGAGCCATGCTTGCTGGG + Intronic
937819929 2:126298522-126298544 GGGGAAGAGCAATCTTACCATGG + Intergenic
938243271 2:129759174-129759196 GGGGATGAGCCATCCTTGCAGGG - Intergenic
938447655 2:131390679-131390701 AGGGAGGAGCCATCCCTGCTGGG - Intergenic
942699781 2:178692797-178692819 AGGTAGGAGCAATCCTCCCTCGG + Intronic
946458630 2:219850343-219850365 AGGGAGGAGGAACACTAGCTGGG + Intergenic
946592100 2:221261944-221261966 TGGGAGGAGCAATTCCAGCTAGG - Intergenic
948546117 2:238730111-238730133 GGGCAGGAGCAGTGCTAGCATGG - Intergenic
1170590260 20:17766017-17766039 GGGGAGGAGAAATGCCAGGTAGG + Intergenic
1174179193 20:48664423-48664445 GGGGAGGAGCTATTTTAGCTGGG + Intronic
1174834098 20:53839819-53839841 GGGGAGGCACCATCCTAGCCAGG - Intergenic
1175106220 20:56616913-56616935 GGGGAGGGGCTAGGCTAGCTAGG - Intergenic
1178310955 21:31529649-31529671 GGGAAGGAGCAATGCTGGATGGG - Intronic
950074926 3:10180582-10180604 GGGGAGGAGCTGTCCTGTCTGGG + Intronic
950139290 3:10604191-10604213 GGGGAGGAGAGATCCTAGAAGGG - Intronic
950257965 3:11521461-11521483 GGGAAGGAGCAAGCCAAGCAAGG + Intronic
950442655 3:13019054-13019076 GGGGGGGAGCCATGCCAGCTGGG - Intronic
951149122 3:19266377-19266399 GGGGAGTAGCATTCCTGGCAGGG - Intronic
952584277 3:34872568-34872590 GGTGAGGAGAGATCCTGGCTGGG + Intergenic
953266454 3:41393872-41393894 GGGCTGGAGCAATCCAACCTGGG + Intronic
954332069 3:49896441-49896463 GGCGAGGAGCAATCACAGGTGGG - Intronic
955754994 3:62217584-62217606 GTGCAGGAGGAATCCTTGCTGGG + Intronic
956622881 3:71238757-71238779 GGACAGGAGCAATCCTAGATGGG - Intronic
961137746 3:124527634-124527656 GGGGAGAAGCAATTTTATCTAGG + Intronic
961803853 3:129474591-129474613 GGGAAAGAGCATTCCTGGCTGGG + Intronic
967863264 3:194169486-194169508 GGAAAGGAGAAATCGTAGCTGGG + Intergenic
969380634 4:6794767-6794789 GAGGAGGAGCCATCATAGCGTGG + Intronic
969518586 4:7662373-7662395 AGGGAGGAGCATTCCCAGCAGGG - Intronic
972229000 4:37048727-37048749 TGGGAGGAGCATGCCTAGCCTGG - Intergenic
973809659 4:54557551-54557573 GGGGAGGGGTAATGCTTGCTTGG + Intergenic
974416798 4:61618557-61618579 GGGGAGGAGGGATCTTAGATGGG + Intronic
987011832 5:13774201-13774223 GGTGAGCAGCAATGATAGCTTGG + Intronic
989272560 5:39550158-39550180 GGGGAGGAGCAATTTCAGCTAGG - Intergenic
990556619 5:56942910-56942932 GGGCTCGAGCAATCCTACCTTGG - Intronic
998453143 5:142250081-142250103 GGGCAGGAGGAAACCTAGCCTGG - Intergenic
1000134835 5:158337213-158337235 GGGGATGAGCATTCCTTGCTGGG + Intergenic
1000338878 5:160261686-160261708 GGGGAAGAGCATTCCCAGCCCGG - Intronic
1002025383 5:176393092-176393114 GCGCAGGAGGAAGCCTAGCTTGG + Intronic
1002332593 5:178454928-178454950 GGGATGGAGCAGTCCTAGCCAGG - Intronic
1002368815 5:178733525-178733547 GGGGAGGAGACATCTCAGCTGGG + Intergenic
1003772639 6:9323846-9323868 GGGGAAGAGCAATTCTAACAAGG + Intergenic
1003810111 6:9769781-9769803 GGGGAGCAGCTAACCTAGCAGGG + Intronic
1004462223 6:15848275-15848297 GGTGAGAAGCGATGCTAGCTTGG - Intergenic
1007264312 6:40585708-40585730 GGGGAGGAGCAAAGCTAGGGAGG - Intronic
1016874854 6:148854658-148854680 GGGAAGGAGCAAGGATAGCTGGG + Intronic
1018668839 6:166163242-166163264 CGGGAGGTGCCTTCCTAGCTGGG + Intronic
1018715814 6:166532127-166532149 GGGAAGGAGCCACCCTACCTCGG - Intronic
1021579708 7:22139808-22139830 GGGGAAGACTAATTCTAGCTGGG + Intronic
1023912025 7:44563079-44563101 AGGGAACAGCAATCCTAGCAGGG - Intergenic
1028704336 7:93820795-93820817 GGAGAAGTGCAATCCTAGCATGG - Intronic
1030979301 7:116167343-116167365 GTGGAGGAGACATTCTAGCTGGG - Intergenic
1034868925 7:154665561-154665583 TGGGAGGAGCAATTGTATCTGGG - Intronic
1037357309 8:18035060-18035082 GGGGAGGTGCAATTTTAGGTTGG - Intergenic
1045269277 8:100648703-100648725 GGTGAGAAACTATCCTAGCTTGG + Intronic
1049517501 8:143069033-143069055 GGGGCTGTGCCATCCTAGCTGGG + Intergenic
1053139485 9:35673865-35673887 GGGGAGGAGCAAGCCTGGAGGGG - Exonic
1060800996 9:126545854-126545876 GGGGAGGAGGAGTCCTGGCTTGG + Intergenic
1061285453 9:129620131-129620153 GGGGAGGAGCTCTCCTAGGAAGG + Exonic
1062655509 9:137602716-137602738 GGGCAGGAGAAATGCTGGCTTGG - Intergenic
1189783907 X:44542641-44542663 GGGGAGGAAAAAGTCTAGCTCGG + Intronic
1190284759 X:48954776-48954798 GGTGAGAAGCAAGCATAGCTAGG + Intronic
1191723931 X:64259064-64259086 GGGGAGGAATAAGCCTACCTGGG + Intergenic
1192142884 X:68660225-68660247 GATGAGGAACAATCCCAGCTGGG - Intronic
1192575826 X:72242340-72242362 GGGGAGGAGCAGCCAGAGCTGGG - Intronic
1192757470 X:74061750-74061772 TGGGAGGAGCAATCCTTCCAAGG - Intergenic
1198715936 X:139558072-139558094 GGGGAGTGGCAATGGTAGCTAGG - Intronic