ID: 922480428

View in Genome Browser
Species Human (GRCh38)
Location 1:225936896-225936918
Sequence ACCTGGATTCTGGTTCTGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922480428 Original CRISPR ACCTGGATTCTGGTTCTGAC AGG (reversed) Exonic
900086354 1:899640-899662 ACCAGGATGCTGATTCTGAAAGG + Intergenic
900733097 1:4275859-4275881 ACCAGGATTCTGGGTGTGAGGGG + Intergenic
904475702 1:30763478-30763500 GCCTGGTTTCTGGTCTTGACTGG + Intergenic
904747142 1:32718316-32718338 AGCTGGATTCTGGTTAGAACAGG - Intergenic
906963221 1:50432115-50432137 GCCAGAATTCTGGTTCTGAAGGG - Intergenic
907462864 1:54615648-54615670 GCCTGGATTCTGACTGTGACTGG + Intronic
907902202 1:58751193-58751215 ATCTGGAGTCTGGTGCTGCCAGG - Intergenic
908351238 1:63287348-63287370 TCCTGGATTCTGGGTCTGTGGGG - Intergenic
912584125 1:110746411-110746433 ACCTGGATTATGGTTTACACTGG - Intergenic
915976888 1:160397341-160397363 ACCTGGGTTCTGGGTGTGAGGGG - Intergenic
916465344 1:165068777-165068799 AACTGGACTCAGGTTCTGAAAGG + Intergenic
921456606 1:215379657-215379679 ACCAGGCTTCTGGTACTGCCAGG - Intergenic
922480428 1:225936896-225936918 ACCTGGATTCTGGTTCTGACAGG - Exonic
923667719 1:236013741-236013763 ACCTGGGTTCTGCCTCTGATGGG + Intronic
1063422201 10:5921926-5921948 ACCTAGGCTCTAGTTCTGACTGG + Intronic
1064018534 10:11791419-11791441 ACCTGGATTCTGGTTCTACGTGG - Intergenic
1067567808 10:47350907-47350929 ACCTGTATTCTGTCTTTGACAGG + Exonic
1068054404 10:51993581-51993603 GCCAGGATTCTGGCTCTCACTGG + Intronic
1069984120 10:72272543-72272565 GCTTGGATTCTGGTTCTTTCAGG + Intergenic
1070072917 10:73107081-73107103 ACCTGGATTGTATCTCTGACTGG - Intergenic
1070555908 10:77527625-77527647 ACCTGCCTTCTGGTTATAACTGG - Intronic
1070786011 10:79162594-79162616 ACCTGGATTCAAATCCTGACTGG + Intronic
1071236595 10:83657198-83657220 TCCTGGATCCTGGTTCTGCAGGG + Intergenic
1071953291 10:90729088-90729110 ACTGGGATTCTGTTTCTTACAGG - Intergenic
1074262073 10:111864012-111864034 ACCTGGTTTCTGATTCTACCTGG + Intergenic
1079017428 11:16881239-16881261 ACCTGCTTTCTTGTTCTTACCGG + Intronic
1080004588 11:27393381-27393403 TCCTGGGTCCTGGTTCTGTCAGG + Intronic
1091034150 11:132218105-132218127 CCCCGGATGCTGGTGCTGACAGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1091748455 12:3008079-3008101 GCATGGACTGTGGTTCTGACGGG + Intronic
1093882891 12:24425839-24425861 ACCTGAATTCTAATTCTGCCTGG - Intergenic
1096423268 12:51478798-51478820 ATCAGGATTCTGGTTGTGACTGG + Intronic
1098448539 12:70592807-70592829 GCCTGGATTCTGGTTCAGACTGG + Intronic
1099347221 12:81517282-81517304 TCCTGGATCCTTGTTCTGCCGGG - Intronic
1101658393 12:106744678-106744700 CTCTGGGTTCTGGTTCTGCCAGG - Intronic
1101870561 12:108562371-108562393 TGCTGGATTCTGGTTGAGACAGG - Intergenic
1102229431 12:111252360-111252382 ACCTGGGTTCTGGTTTTAACTGG - Intronic
1104624993 12:130344727-130344749 GCCTGGAATCTGGATCTGGCAGG - Intronic
1106419803 13:29576873-29576895 GCCTGGTCTCTGGTGCTGACCGG - Intronic
1107915013 13:45140902-45140924 ACCTGGCTTCTAGTCCTGAATGG + Intronic
1108777555 13:53784775-53784797 ACCTAGATTATGGGTCAGACAGG - Intergenic
1110563425 13:76934275-76934297 ACATGGATTCTGATTCTGTAGGG + Intergenic
1117116852 14:52522790-52522812 CCCTAGAATCTGGGTCTGACTGG - Intronic
1117287611 14:54302077-54302099 ACCTGCACTCTGCTTCTGCCTGG - Intergenic
1117872590 14:60216932-60216954 ACCTGGAAGCTGGTGCTAACTGG + Intergenic
1121498975 14:94418515-94418537 ACCTTCATTCTGGTTCCAACAGG - Intergenic
1121622591 14:95360725-95360747 ACCCCGATTCTGGTTCTGGTTGG - Intergenic
1125470182 15:39994694-39994716 GCCTGGGTTTTGGTTCTGACAGG + Intronic
1127430392 15:58901434-58901456 ACATGGACTCTGGTTCTGATTGG - Intronic
1127843721 15:62851348-62851370 ACTTAGGTTCTGGTTCTGGCTGG + Intergenic
1129508811 15:76104859-76104881 TCCTGGAAGCTGGCTCTGACAGG - Intronic
1131062710 15:89413805-89413827 AACTGCAGTCTGGTTCTGTCTGG - Intergenic
1134257296 16:12622772-12622794 ACATGGAGTCTCGTTCTGTCAGG + Intergenic
1134588926 16:15435821-15435843 AACTGTGTTCTGATTCTGACGGG + Intronic
1134907805 16:17996120-17996142 AACAGGATTCTGGATCTGAGAGG + Intergenic
1135495456 16:22947927-22947949 ACTTGGATTCTGGAGCTGAAAGG - Intergenic
1136369128 16:29825071-29825093 ACCTGGTTTCTGCTTTGGACAGG + Intronic
1137814066 16:51381593-51381615 ACCTGGAGTCAGGTCCTGCCAGG - Intergenic
1142941513 17:3383510-3383532 ACCTGGATTTTCATCCTGACTGG - Intergenic
1143291678 17:5836149-5836171 CCCTGGATTCTGTTTGTGAAAGG + Intronic
1144205845 17:12979062-12979084 ACCTGGATTCTGATGCCCACAGG - Intronic
1144713009 17:17414754-17414776 GCCTGGGTTCTGGTTCACACTGG - Intergenic
1145984320 17:29034901-29034923 ACCTGGCTGCTGGTTTAGACAGG - Intronic
1146512008 17:33458020-33458042 AAGGGGATTCTGATTCTGACAGG + Intronic
1146530524 17:33604212-33604234 ATCTGGATTCTAATTCTGAATGG - Intronic
1147434490 17:40400527-40400549 ACCTGGGTCCATGTTCTGACGGG + Exonic
1148089990 17:45017797-45017819 ACCTGGATTCAGGATTTGATGGG + Intergenic
1150814567 17:68382864-68382886 TCCTGGGTTCTGGCTCTAACAGG - Intronic
1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG + Intronic
1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG + Intronic
1152498291 17:80690645-80690667 CCCTAGATTCTGGTTCAGTCAGG + Intronic
1152538790 17:80964554-80964576 ACCTGGATGCTGGTGCTCAGTGG - Exonic
1157169164 18:45386226-45386248 ACCTGGAATCTACTTCTGGCTGG + Intronic
1157358820 18:46960116-46960138 AACTAGATTCTGGTTCTGGAAGG + Intronic
1157582576 18:48782139-48782161 CCCTGGGTCCTGGTTCTGGCAGG - Intronic
1158702726 18:59763353-59763375 ACATGGATTCTGGTTGTCTCTGG - Intergenic
1158721418 18:59928539-59928561 ACCTGCACTTTGGTTCTGATTGG + Intergenic
1159500192 18:69258844-69258866 AAATGGATTGTGGTTATGACAGG + Intergenic
1160556808 18:79730825-79730847 ACCTGGATTTTGGTCCTGTGAGG + Intronic
1161527150 19:4763390-4763412 AGCTGGATTCTAGTCCTGGCTGG + Intergenic
1162136647 19:8559454-8559476 ATCTGGGTTCTGATCCTGACTGG + Intronic
1163159487 19:15456400-15456422 ACCTGGATTCTGGTAGTGAGTGG - Intronic
1164572985 19:29387483-29387505 ACCTGGTTTCTGTATCTGCCAGG + Intergenic
925313343 2:2903554-2903576 ACCTTGTTTCAGGTTCTGCCCGG + Intergenic
926340354 2:11900044-11900066 AGCTGGATTCTAGTTCTGTTGGG + Intergenic
926693107 2:15750994-15751016 TCCTGGATACTGGGTCTGGCTGG - Intergenic
927018790 2:18996501-18996523 GCCTGGATTCTTTATCTGACTGG - Intergenic
928541164 2:32284789-32284811 ACCTGGATTCTGTTTGTCTCAGG - Intronic
929441052 2:41966100-41966122 AACTGGACTCTGGTTAGGACCGG + Intergenic
932266206 2:70369026-70369048 ACCCGGATCCTGTCTCTGACAGG + Intergenic
932685547 2:73866210-73866232 TGCTGGATTCTGGATCTAACAGG - Exonic
933507086 2:83191176-83191198 CACTGGATTATGTTTCTGACAGG - Intergenic
937992606 2:127672905-127672927 GCCTGGATCCTGGTTCTCTCGGG - Intronic
940192241 2:151054271-151054293 ACCTGGATTTTTATTTTGACTGG - Intergenic
942131587 2:172885354-172885376 ACCTGGTCTCTGGGTCTGTCTGG + Intronic
943580201 2:189674926-189674948 ACGTGGGTTCTGTTTCTGAAAGG + Intronic
944572562 2:201059355-201059377 ACTTGGATTCCTGTTCTGAGAGG - Intronic
945092562 2:206189309-206189331 ACATGTATTTTGCTTCTGACCGG + Intronic
947413323 2:229866874-229866896 GCCTGTATTCTGCTTTTGACTGG - Intronic
949046596 2:241875072-241875094 GCCTGGATTCTGGTTTTTCCTGG - Intergenic
1173045155 20:39502729-39502751 ACCAGGATCCTGGTTCAGCCAGG + Intergenic
1173083084 20:39888339-39888361 ACCTGGTTTCTGGTCCTTGCTGG - Intergenic
1179197092 21:39174360-39174382 ACCTGGAATCTGGTCCTAGCTGG - Intergenic
1180150117 21:45943068-45943090 ACCTGGATCCTGGTGTTCACGGG + Intergenic
1181492477 22:23269182-23269204 GGCTGGGTTCTGGTTCTGGCTGG - Intronic
1184191088 22:42895001-42895023 ACCAGGATTCTGGTTCTCACAGG - Intronic
949833780 3:8245873-8245895 ACCTAGATTCTGGCTCTGATAGG - Intergenic
952131764 3:30372166-30372188 ACATGGATTCTAATTCTGAAGGG + Intergenic
952251763 3:31662966-31662988 GGTTGGATTCTGGTTCAGACAGG - Intronic
952273933 3:31859142-31859164 ACCTGGTTTCTGGCTGTGCCTGG - Intronic
953457405 3:43054091-43054113 CCCTGGACTCTAGTTTTGACAGG - Intronic
954090673 3:48281539-48281561 ATCTGGAGTCTGGGTCTGAGAGG + Intronic
955476662 3:59343354-59343376 GCCTGGATGCTGGTTCAGGCAGG - Intergenic
959786119 3:110300055-110300077 ACCTGTATTTTGGATCTGAGTGG - Intergenic
960860372 3:122146694-122146716 ACCTGGAGTCTGGCCCTGTCAGG - Intergenic
962265771 3:133943204-133943226 CCCTGGGTTCTGATTCTGTCAGG + Intronic
964763573 3:160157263-160157285 ACCTGGGTTCTGGCAGTGACAGG + Intergenic
964851343 3:161099545-161099567 ACAAGGATTCTAGTTCTGGCAGG + Intronic
965751636 3:171980767-171980789 ATTTGGATGCTGGTTCTGTCTGG - Intergenic
967131129 3:186471677-186471699 AACTGGAATCTGGCTCTGTCTGG + Intergenic
968657942 4:1786700-1786722 AGGTGGCTTCTGTTTCTGACAGG + Intergenic
970610686 4:17722314-17722336 CCCTGGATTCGGGTGCTGAGAGG + Intronic
975949303 4:79748863-79748885 GCCTGGATTCTGGTACTGTGGGG - Intergenic
978446736 4:108787474-108787496 ACCTGGATCCTGCCTCTCACGGG - Intergenic
986468312 5:8049420-8049442 ACCTGGTTTCTGCCTCTGAGGGG - Intergenic
992370383 5:76137729-76137751 ACATGGCTACTGGTTCTGAAGGG - Intronic
993466255 5:88250464-88250486 GTCAGGATTCTGGTTCTGAGAGG - Intronic
994763547 5:103887125-103887147 ACCTGGATACTAATTCTGAATGG - Intergenic
995091882 5:108187743-108187765 AGCTGGATTGTGTTTCTGAAGGG - Intronic
995374141 5:111454495-111454517 GCCTGGAGTTTGGTTTTGACTGG - Intronic
999991275 5:157052359-157052381 ACCTGGTTCATGGTTCTGCCTGG + Exonic
1004299683 6:14445902-14445924 ACCTGGGTTCAAATTCTGACTGG - Intergenic
1008129004 6:47699556-47699578 ATCTGGATTCAGATTCTGATAGG - Intronic
1008180366 6:48320674-48320696 ACGTGGTTTCTGTTTCTTACTGG - Intergenic
1011740539 6:90355264-90355286 CCCTGCATTCTGGTTCTGGATGG + Intergenic
1012326225 6:97921460-97921482 ACCTGGAGTCAGCTTCTGATGGG + Intergenic
1012868175 6:104642750-104642772 ACCTGGATCCTCCTTCTCACAGG + Intergenic
1017071245 6:150577005-150577027 GCCTGATTTCTGGTTCTGAGCGG - Intergenic
1017984088 6:159427260-159427282 GCCTGGAAGCTGGTTCTGCCTGG - Intergenic
1018435135 6:163752451-163752473 ACCAGGATGCTGGTTCTGTGGGG + Intergenic
1019845420 7:3494992-3495014 ACCAGGTTTATGGTTCTGACAGG - Intronic
1020457840 7:8394463-8394485 ATCTGAATCCTGGGTCTGACTGG + Intergenic
1020977630 7:15026548-15026570 CCCTGGATTTTGTATCTGACGGG + Intergenic
1021587851 7:22228832-22228854 GCCTGGATTCTTTTCCTGACTGG - Intronic
1021597294 7:22330865-22330887 ACCTGTATTCTGGGTCAGAGAGG - Intronic
1022248559 7:28584539-28584561 TCCTGGATTCTGGTGGTGGCTGG - Intronic
1026513816 7:71049633-71049655 ACCTGGAGTCTGGTGCTGTGGGG - Intergenic
1026947431 7:74325397-74325419 ACCTGGAGGCTGGTGCAGACAGG + Intronic
1033151992 7:138923078-138923100 ACCTGGCTTCTAATTCTGTCAGG - Intronic
1034964860 7:155384627-155384649 ACCTGGATTCTGGTTCAGGGCGG - Intronic
1035037807 7:155906797-155906819 CCCTGGACTCTGGTTCTCCCTGG + Intergenic
1035361835 7:158318490-158318512 ACCTGGCTTTTGGTTCTTCCTGG - Intronic
1036688757 8:10928202-10928224 GCCTGGATTCTGGTCCCGTCCGG - Intronic
1037374567 8:18213644-18213666 ACCTGTAGTCTGGTGCTGCCTGG + Intronic
1040980847 8:53244908-53244930 CCATGGATTTTGGATCTGACGGG - Intronic
1043684427 8:83068623-83068645 ACCTGGATTCATGTTGTCACAGG - Intergenic
1048143190 8:131815711-131815733 CTCTAGATTCTGGTTCTGACTGG + Intergenic
1052353228 9:27478289-27478311 ACGTGGCTTCTCCTTCTGACTGG - Intronic
1053266372 9:36717193-36717215 ACCTGGCTCCAGGTTCTTACTGG + Intergenic
1054840687 9:69735770-69735792 AGCTGGATTCTGGTTTTCTCTGG - Intronic
1057259176 9:93574981-93575003 ACCTGAATTCCGGTTGTCACTGG - Intergenic
1057291843 9:93811855-93811877 AGGTGGGTGCTGGTTCTGACTGG + Intergenic
1058820709 9:108727280-108727302 TCCTGGATGCTGGGTCTGATTGG + Intergenic
1061560042 9:131396021-131396043 AGCTGGATTCTGGTCCTCATCGG + Intronic
1188713796 X:33435245-33435267 ACCTGTCTTCAAGTTCTGACTGG - Intergenic
1189726707 X:43974785-43974807 AGGTGGATTCTGTTTGTGACTGG - Intergenic
1196496471 X:116329540-116329562 ACCTGGCTTGTTGTTCTGATTGG + Intergenic
1196566389 X:117210192-117210214 GCCTGGATTCTGGTTCTACACGG - Intergenic
1196692695 X:118577294-118577316 ACCTGGCTTCGGGTACTGCCGGG - Intronic
1196721010 X:118853890-118853912 AGCTGGAATCTGGTTCTGTTGGG - Intergenic
1197836099 X:130695412-130695434 AACTGGACCCTGGTTCTTACTGG + Intronic
1201466720 Y:14289615-14289637 ACCTGGGTTCAAATTCTGACTGG + Intergenic
1202098736 Y:21282429-21282451 ACATGGATTTTGTTTCTGCCTGG + Intergenic