ID: 922480471

View in Genome Browser
Species Human (GRCh38)
Location 1:225937164-225937186
Sequence CAATGCACACATTTTCAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922480471 Original CRISPR CAATGCACACATTTTCAGCT GGG (reversed) Exonic
900507296 1:3036110-3036132 CAAAGCACACTTTGGCAGCTAGG - Intergenic
900905814 1:5556561-5556583 CAACACACAGATTTTCACCTAGG + Intergenic
903168658 1:21538611-21538633 CAATGGACACATCCTCTGCTAGG + Intronic
908676123 1:66605993-66606015 CCATGCACATCTTTTCATCTGGG + Intronic
908994393 1:70134002-70134024 AGATGCACACATATTCAGATTGG - Intronic
909912862 1:81281607-81281629 AAATGAAGATATTTTCAGCTTGG - Intergenic
914964916 1:152247478-152247500 CATATCATACATTTTCAGCTAGG - Intergenic
919919070 1:202157651-202157673 CAAAGTACACAGTTTCAGCCAGG - Intronic
919947381 1:202329536-202329558 AAATGAACACATTTCCAGATAGG + Intergenic
920855622 1:209658924-209658946 CAAAGCACAGATGCTCAGCTTGG - Intergenic
920936077 1:210436246-210436268 CAGTGAACTCATTTTCAGCAAGG - Intronic
921672994 1:217946908-217946930 CAAAGCTCCCATCTTCAGCTTGG + Intergenic
922480471 1:225937164-225937186 CAATGCACACATTTTCAGCTGGG - Exonic
924286855 1:242496152-242496174 CATTGCAAACATTTTCTGGTTGG - Intronic
1063665190 10:8056397-8056419 CAATTCGCACATTTTCAGAAAGG + Intronic
1064314356 10:14240967-14240989 CAATGCAGACATTTGCAGCCTGG - Intronic
1068533953 10:58219596-58219618 CAAAGGACACCTTTTCGGCTAGG + Intronic
1069165218 10:65148433-65148455 AAATACACACATCTTCAGATAGG + Intergenic
1071233478 10:83616714-83616736 CAATTCATTCATTTTCTGCTTGG - Intergenic
1071360002 10:84837243-84837265 CAGTGCACACATTTCAAGTTGGG - Intergenic
1071708826 10:88028735-88028757 CAAAGAAGACATTTTCAGCCTGG - Intergenic
1071753718 10:88511507-88511529 CCAAACACACATCTTCAGCTTGG - Intronic
1072309538 10:94141317-94141339 GAATACACCCATTTTGAGCTGGG + Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072900865 10:99405211-99405233 GAATATACACACTTTCAGCTAGG + Intronic
1073736063 10:106348174-106348196 CAAAGCACACATTTTCCCCATGG + Intergenic
1075974656 10:126685048-126685070 AAATGCACACATTTTGGGTTTGG + Intergenic
1078680203 11:13468671-13468693 TAATTCAGACATTTTCACCTAGG - Intergenic
1081232397 11:40601827-40601849 CACTGCACCCAATTTCAGATTGG + Intronic
1081234280 11:40627143-40627165 AAATGTAGACATTTTCATCTAGG + Intronic
1083496320 11:63057415-63057437 CAATACACAGATTTTAGGCTAGG - Intergenic
1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG + Intronic
1087736437 11:101839583-101839605 CAATGGACACATTTTCTGGTGGG + Intronic
1088397798 11:109387993-109388015 CAATTAAGCCATTTTCAGCTAGG + Intergenic
1089666525 11:120023870-120023892 CAATGCACTTCTTTTCACCTGGG - Intergenic
1089677383 11:120098917-120098939 AAATGCACACAGATGCAGCTGGG - Intergenic
1090602541 11:128388258-128388280 CAATGTACACAAATACAGCTGGG - Intergenic
1091896568 12:4109910-4109932 CAATGCACACACCTTGAGTTTGG + Intergenic
1093473750 12:19532706-19532728 AAACCCACACATTTTCAGCAGGG - Intronic
1094090014 12:26638980-26639002 CAAAACACTCATTTTCACCTAGG + Intronic
1097272236 12:57783141-57783163 CAAGGCACACATTTTATGCTGGG + Exonic
1097861118 12:64519567-64519589 AAATGCACAGATTTCCAGTTGGG - Intergenic
1100419891 12:94422925-94422947 CTGTGGACACATTTTCAGTTTGG + Intronic
1104452747 12:128884426-128884448 AAAAGCACAAAATTTCAGCTAGG + Intronic
1105581399 13:21699969-21699991 CAATGCACACATTTTTGCCTGGG + Intronic
1105693344 13:22864047-22864069 CAACGCTCAACTTTTCAGCTGGG - Intergenic
1106027528 13:25969151-25969173 TAATGCTAACATTTTCTGCTGGG + Intronic
1107380031 13:39847057-39847079 CGATGTACTCATTGTCAGCTTGG - Intergenic
1108405674 13:50099595-50099617 CAGTGCACACACCTTCAGTTTGG - Intronic
1108675439 13:52733816-52733838 CACTGCAGACGTGTTCAGCTGGG - Intronic
1109796961 13:67328052-67328074 CAATTCTCACAATATCAGCTTGG + Intergenic
1110366558 13:74692912-74692934 CAAAGCACACTTCTTCAGCTTGG + Intergenic
1112818471 13:103301881-103301903 CACTGTGCACATTTCCAGCTCGG - Intergenic
1113595887 13:111531919-111531941 AAATGCACACATTTTATACTTGG - Intergenic
1115152137 14:30297839-30297861 GAATCCACCCACTTTCAGCTAGG + Intergenic
1115734587 14:36310880-36310902 CAATCTCCACATTTTTAGCTGGG + Intronic
1116866329 14:50034688-50034710 CAAACCCCACCTTTTCAGCTGGG + Intergenic
1117246247 14:53889556-53889578 CAATGCCCACATTTTAATTTAGG - Intergenic
1120951625 14:90046931-90046953 CACTACACACAAGTTCAGCTTGG + Intergenic
1121019186 14:90568701-90568723 CTCTGCAGACATTTTCTGCTTGG - Intronic
1121361321 14:93263156-93263178 CAATGCACAAAAATTAAGCTTGG + Intronic
1122385076 14:101339281-101339303 CAACACACACATGTTCACCTGGG + Intergenic
1122587831 14:102822497-102822519 ATACGCACACATTTTCAGTTTGG - Intronic
1202831301 14_GL000009v2_random:35887-35909 CAATGCACGGATTTTCATGTTGG - Intergenic
1123625921 15:22226748-22226770 CCCTGCACAGATTTTCACCTAGG + Intergenic
1123845195 15:24293234-24293256 CAATGTACACATTTTCTAATTGG - Intergenic
1124588164 15:31029522-31029544 AAATGCAAATATTTTAAGCTTGG + Intronic
1126479824 15:49105609-49105631 CAAAGCGCACATTCTGAGCTGGG + Intergenic
1127006657 15:54578256-54578278 AAATGTACATATTTTTAGCTCGG + Intronic
1127337789 15:58006789-58006811 TGATGCACAAATTCTCAGCTGGG + Intronic
1127587291 15:60390620-60390642 ACATGCAAACATTTTCAACTGGG + Intronic
1128294010 15:66501758-66501780 CAATGAGCACATTTACAGTTTGG - Intronic
1132034610 15:98472043-98472065 TAAGGCACACATTCTCAGCAAGG - Intronic
1138228671 16:55322684-55322706 CTATCCACACATTTGCAGCTTGG - Intergenic
1138773964 16:59697905-59697927 CAATGCACAAGACTTCAGCTGGG + Intergenic
1141473909 16:84259010-84259032 AAATGCTCTCATTTTTAGCTAGG - Intergenic
1141739057 16:85878176-85878198 GAAAGCACACACTTTCAGCTGGG + Intergenic
1142199323 16:88753575-88753597 CAATGCCCCCATTTTCAGATGGG + Intronic
1146724716 17:35147898-35147920 CCATGCTCACTTTTTCAGCAAGG - Exonic
1147117133 17:38309198-38309220 CAAAGCACACAAAGTCAGCTGGG - Intronic
1148412548 17:47480403-47480425 CAAAGCACACAAAGTCAGCTGGG + Intergenic
1149178949 17:53910981-53911003 CAATGCACAGATGCACAGCTTGG - Intergenic
1149214514 17:54338297-54338319 CAATGCAGAAAGTTTGAGCTGGG - Intergenic
1150370598 17:64634250-64634272 AAATCCCCTCATTTTCAGCTGGG + Intronic
1150485351 17:65539304-65539326 CAAGGCCCATCTTTTCAGCTGGG - Intronic
1156759900 18:40575918-40575940 AAATTCACAAATTTTCACCTTGG - Intergenic
1156854586 18:41766963-41766985 CGATGCACACATTTTTGGTTTGG - Intergenic
1157455009 18:47818678-47818700 AAATGCTTACATTTTTAGCTAGG - Exonic
1158773159 18:60546401-60546423 AAATGCACTCATTTTCAGTCTGG + Intergenic
1159105031 18:63995359-63995381 CAGTGCACAGATGTTCAGCATGG - Intronic
1159109274 18:64038003-64038025 CAGTGTACACATTTTCACCATGG + Intergenic
1168264997 19:55217954-55217976 CCCTGCCCACATTTTCATCTTGG - Intergenic
1168447157 19:56429476-56429498 CAAGGCAAGCATGTTCAGCTTGG + Intronic
1202641397 1_KI270706v1_random:91857-91879 CAATGCACGGATTTTCATGTTGG + Intergenic
926589429 2:14724353-14724375 CAAAGCTAACATTTTCAGCGTGG + Intergenic
931814489 2:65887468-65887490 AAATGCAAACCATTTCAGCTTGG - Intergenic
933679615 2:85088249-85088271 AAAAACACACATTGTCAGCTGGG + Intergenic
934475693 2:94591879-94591901 CAGTGCCCACTCTTTCAGCTGGG + Intronic
935973857 2:108558195-108558217 AAATGCACAAATCTTCAGGTGGG - Intronic
936801552 2:116274108-116274130 CAAAGCACACTTTTTAAGGTGGG - Intergenic
936917750 2:117657157-117657179 CAATGCATACATTTTCTTTTAGG - Intergenic
939171327 2:138699687-138699709 CAAGGGACACATTTTCTGCAAGG + Intronic
939809973 2:146819138-146819160 AAATGCACAACTTTTCAGTTGGG - Intergenic
940365128 2:152839855-152839877 CAGTGCACATGCTTTCAGCTGGG + Intergenic
943496169 2:188623407-188623429 TAATGCACACAACTTAAGCTTGG - Intergenic
945491292 2:210458392-210458414 AAATGCACCCATTTTAAGCGTGG + Intronic
945711082 2:213295177-213295199 TAATTCACACATTTTAAACTTGG + Intronic
947564993 2:231188095-231188117 CAAACCAAACATTTTTAGCTGGG - Intergenic
1170850766 20:20002649-20002671 CAATGAAAACACTTTCAGGTGGG - Intergenic
1173120577 20:40285728-40285750 CAATGCACACAATTTGAGACTGG + Intergenic
1173728798 20:45314468-45314490 GAATGCACACTTGTGCAGCTGGG - Exonic
1173998047 20:47354745-47354767 CAGTACATAAATTTTCAGCTTGG - Intronic
1175032580 20:55970417-55970439 CCATGCACACATTTTAAGCATGG + Intergenic
1176610488 21:8880718-8880740 CAATGCACGGATTTTCATGTTGG - Intergenic
1176884098 21:14233361-14233383 CAATGAAGACATAGTCAGCTTGG - Intergenic
1176999991 21:15600283-15600305 CTAGGCCCACATTTTAAGCTTGG + Intergenic
1177175976 21:17701108-17701130 AAATGTAAACATTTTCTGCTTGG + Intergenic
1179240180 21:39583285-39583307 AAATGATCACATTTTCAGGTTGG + Intronic
1180360560 22:11890020-11890042 CAATGCACGGATTTTCATGTTGG - Intergenic
1184728761 22:46361687-46361709 CAGTGCTCACATTTTCATCAGGG + Exonic
949231590 3:1756864-1756886 CCATGCAGGCATTTTCATCTTGG + Intergenic
949643313 3:6065031-6065053 CATTGCTCAGATTTTCTGCTCGG + Intergenic
949764353 3:7509761-7509783 CAAGGCTTATATTTTCAGCTGGG + Intronic
950587108 3:13901246-13901268 CAATGAGTACTTTTTCAGCTAGG + Intergenic
954477459 3:50761508-50761530 CTAGGCCCACATTTTAAGCTTGG - Intronic
955549494 3:60068295-60068317 GAAAGCAAACATTTTCAGCTTGG - Intronic
956065180 3:65390175-65390197 CAGTGACCACATTTGCAGCTAGG + Intronic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
956632441 3:71329641-71329663 CAATAAACACATTTGCAGGTGGG + Intronic
961749282 3:129085989-129086011 CCCTGCACACATTTGCCGCTGGG - Intergenic
962195119 3:133355100-133355122 CAGTGCACAGATATTCAGCTGGG + Intronic
962268967 3:133964088-133964110 AAATGCACTCAGTTTCATCTTGG + Intronic
962634249 3:137313928-137313950 CACTGCACATCTTTTCAACTGGG - Intergenic
963846899 3:150168360-150168382 CAATCCTCAAATTTTCAGGTAGG + Intergenic
964218857 3:154321661-154321683 GAATGCATTCATTTTCAGCCAGG + Intronic
965456284 3:168904775-168904797 CAATACCCTCATTTTCAGATGGG - Intergenic
967302640 3:188030776-188030798 GAATGCACACATTTTCTTCTTGG - Intergenic
967759785 3:193210680-193210702 CAAAGCACACATTTTCTGCAAGG - Intergenic
1202737168 3_GL000221v1_random:15503-15525 CAATGCACGGATTTTCATGTTGG - Intergenic
969661334 4:8530851-8530873 CAAGGCACCCATTCTCAGTTTGG - Intergenic
972588597 4:40462124-40462146 CAGTGCAGACATTTGAAGCTAGG + Intronic
973384905 4:49502384-49502406 CAATGCACGGATTTTCATGTTGG + Intergenic
974866242 4:67584168-67584190 CAATGCTAACATTTGCAGCAGGG + Intronic
976662727 4:87556656-87556678 TAATGCAGACATTTTCAGAAAGG + Intergenic
977542504 4:98334376-98334398 CAATGTTTACATTTTTAGCTAGG + Intronic
977857802 4:101914981-101915003 CAAAGCACACATTCCCAGCTGGG - Intronic
978943880 4:114471302-114471324 CAAGGCAGAAATTTTCAGATTGG - Intergenic
981541145 4:145847330-145847352 GAAAGCAGAAATTTTCAGCTGGG - Intronic
982591185 4:157313700-157313722 ACACACACACATTTTCAGCTAGG - Intronic
982750083 4:159150643-159150665 CAACAAACACATTTCCAGCTGGG - Intronic
984152249 4:176148619-176148641 CAATGCACACATATTGCGATGGG + Intronic
984528503 4:180886360-180886382 CAATGCTCAAATGTTGAGCTTGG - Intergenic
984655622 4:182314714-182314736 AAATGCAGAGATTTTCAGATTGG - Intronic
984913431 4:184698256-184698278 CAAGTCACACATTTTCATCCAGG - Intronic
1202768767 4_GL000008v2_random:177715-177737 CAATGCACGGATTTTCATGTTGG + Intergenic
987349037 5:17004983-17005005 TAATGCTTCCATTTTCAGCTGGG - Intergenic
988032089 5:25775874-25775896 AAAGGCACAGATTTTCAGATTGG + Intergenic
989734165 5:44683023-44683045 CAATGCACCTATAGTCAGCTGGG + Intergenic
990739778 5:58900719-58900741 CACTGCACACATTGTGAGCGGGG - Intergenic
993385275 5:87254844-87254866 CAAGGCACACATTAACAGATTGG - Intergenic
996055831 5:118981473-118981495 CAATACATACCTTTTCAACTAGG + Intronic
998606143 5:143636576-143636598 CAAGGCACTCATTTTGTGCTGGG + Intergenic
1003087567 6:3072972-3072994 GAATGCCAACATTCTCAGCTGGG - Intronic
1006279090 6:33032860-33032882 AAATGGACACATTTTGTGCTGGG - Intergenic
1007079124 6:39086266-39086288 CCATGGACACATTTTCTCCTAGG + Exonic
1008942907 6:57066557-57066579 CTATGCAAACATTATCAGCCAGG - Intergenic
1010655272 6:78504379-78504401 CAATGGACACACTTTCAGTTTGG + Intergenic
1012783888 6:103598724-103598746 CCATGCACATATTTCCAGATGGG - Intergenic
1016658503 6:146547487-146547509 CCAAGCACACATTTTATGCTTGG - Intronic
1016995677 6:149961001-149961023 TAAAGCACAGATTTTCGGCTGGG + Intergenic
1017180852 6:151550590-151550612 CAATGCCCTCATTGTCAGCTTGG + Intronic
1017483760 6:154883624-154883646 CAATCCACACATCTACACCTTGG - Intronic
1019602506 7:1892193-1892215 CACTGCACACTTTTGCAGCTTGG + Intronic
1020393006 7:7680325-7680347 CAATGAACTCATTTTCAACAAGG - Intronic
1020600307 7:10267075-10267097 CAATTCACACCCTTTCACCTGGG + Intergenic
1021059772 7:16096951-16096973 CAATGAACACATTTTATTCTTGG + Intronic
1027045694 7:74989967-74989989 AAATGTACAGATTTTCAGGTGGG - Intronic
1029387116 7:100250509-100250531 AAATGTACAGATTTTCAGGTGGG + Intronic
1029846039 7:103413285-103413307 CAATGCAAAGTTTCTCAGCTTGG - Intronic
1030532995 7:110733488-110733510 AAATACACACATTTTTAGCTGGG - Intronic
1031411126 7:121441092-121441114 CAGTGCACACACCTTCAGTTTGG + Intergenic
1031663500 7:124456297-124456319 TATTGCAAACATTTGCAGCTAGG + Intergenic
1032971045 7:137164335-137164357 CAGTGCACACACCTTCAGTTTGG - Intergenic
1035712402 8:1728811-1728833 CAATGCACAGATGTTGGGCTGGG + Intergenic
1043156928 8:76794598-76794620 TATAGAACACATTTTCAGCTTGG - Intronic
1043183234 8:77111513-77111535 CGATGCAGACATTTTCAGGATGG - Intergenic
1043651491 8:82599640-82599662 CAAAGTATACATTTTTAGCTAGG + Intergenic
1043912662 8:85881076-85881098 CAATGCCCAGATTTCCAGGTTGG + Intergenic
1044427142 8:92064990-92065012 AGATGCACACACATTCAGCTAGG - Intronic
1045192268 8:99894572-99894594 CCATGCAAAGATTTTCAGCTGGG - Intergenic
1047821358 8:128524864-128524886 TAATCCACACATTTTCAGGCTGG + Intergenic
1049287061 8:141781595-141781617 CCCTGGGCACATTTTCAGCTGGG - Intergenic
1050771763 9:9210061-9210083 TAATGAAAACATTTTCCGCTGGG - Intronic
1051474755 9:17493708-17493730 CAATGCAAACATTTTAAGTATGG - Intronic
1053682370 9:40494199-40494221 CAGTGCCCACTCTTTCAGCTGGG - Intergenic
1054281344 9:63130730-63130752 CAGTGCCCACTCTTTCAGCTGGG + Intergenic
1054360935 9:64117888-64117910 CAATGCACGGATTTTCATGTTGG - Intergenic
1054393487 9:64634203-64634225 CAGTGCCCACTCTTTCAGCTGGG - Intergenic
1054428137 9:65139417-65139439 CAGTGCCCACTCTTTCAGCTGGG - Intergenic
1054502243 9:65882127-65882149 CAGTGCCCACTCTTTCAGCTGGG + Intronic
1054966384 9:71032395-71032417 AAATGTATACATTTTCAGGTGGG - Intronic
1055600335 9:77910325-77910347 CAATGCATCTATTTTCAGTTAGG - Intronic
1056088177 9:83176431-83176453 AAATGCAGAGATTTTCAGATAGG - Intergenic
1056115775 9:83439993-83440015 CAAAACACACACTTCCAGCTTGG + Intronic
1060067794 9:120518879-120518901 AAAAGCACAAATTCTCAGCTGGG + Intronic
1060448728 9:123716880-123716902 CAATGCCAACATTTTTAGCAGGG + Intronic
1203693650 Un_GL000214v1:71456-71478 CAATGCACGGATTTTCATGTTGG + Intergenic
1203705893 Un_KI270742v1:45952-45974 CAATGCACGGATTTTCATGTTGG - Intergenic
1203558100 Un_KI270744v1:19822-19844 CAATGCACGGATTTTCATGTTGG + Intergenic
1203642623 Un_KI270751v1:32607-32629 CAATGCACGGATTTTCATGTTGG - Intergenic
1187872119 X:23773127-23773149 CAAAACACACATTATCAGCTGGG - Intergenic
1196034330 X:111127317-111127339 CAAAGCAAATATTTTCAGTTAGG - Intronic
1197292692 X:124679040-124679062 AAATGCAAAGATATTCAGCTAGG + Intronic
1198943520 X:141984657-141984679 TAATGGACACATTATTAGCTTGG - Intergenic