ID: 922485877

View in Genome Browser
Species Human (GRCh38)
Location 1:225972655-225972677
Sequence TGGTTCCTTCTCTGGGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922485871_922485877 -3 Left 922485871 1:225972635-225972657 CCTGAGGACAGGGCTCTTTCTGG No data
Right 922485877 1:225972655-225972677 TGGTTCCTTCTCTGGGGATAGGG No data
922485866_922485877 26 Left 922485866 1:225972606-225972628 CCAACAGAGGCAGAGGGGGAAAC No data
Right 922485877 1:225972655-225972677 TGGTTCCTTCTCTGGGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922485877 Original CRISPR TGGTTCCTTCTCTGGGGATA GGG Intergenic
No off target data available for this crispr