ID: 922486939

View in Genome Browser
Species Human (GRCh38)
Location 1:225980754-225980776
Sequence AGGTTGCCAGAGCACTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922486939_922486946 8 Left 922486939 1:225980754-225980776 CCCAGCTAGTGCTCTGGCAACCT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 922486946 1:225980785-225980807 TAACCAGGCCAATTAGGAAAGGG 0: 1
1: 0
2: 1
3: 26
4: 254
922486939_922486945 7 Left 922486939 1:225980754-225980776 CCCAGCTAGTGCTCTGGCAACCT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 922486945 1:225980784-225980806 ATAACCAGGCCAATTAGGAAAGG 0: 1
1: 0
2: 2
3: 11
4: 129
922486939_922486942 -7 Left 922486939 1:225980754-225980776 CCCAGCTAGTGCTCTGGCAACCT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 922486942 1:225980770-225980792 GCAACCTGAAGAGGATAACCAGG 0: 1
1: 0
2: 0
3: 7
4: 88
922486939_922486947 9 Left 922486939 1:225980754-225980776 CCCAGCTAGTGCTCTGGCAACCT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 922486947 1:225980786-225980808 AACCAGGCCAATTAGGAAAGGGG 0: 1
1: 0
2: 3
3: 16
4: 231
922486939_922486944 2 Left 922486939 1:225980754-225980776 CCCAGCTAGTGCTCTGGCAACCT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 922486944 1:225980779-225980801 AGAGGATAACCAGGCCAATTAGG 0: 1
1: 0
2: 0
3: 11
4: 134
922486939_922486949 15 Left 922486939 1:225980754-225980776 CCCAGCTAGTGCTCTGGCAACCT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 922486949 1:225980792-225980814 GCCAATTAGGAAAGGGGCACTGG 0: 1
1: 0
2: 1
3: 21
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922486939 Original CRISPR AGGTTGCCAGAGCACTAGCT GGG (reversed) Intergenic
903805883 1:26005422-26005444 CAGCTGCCAGAGCCCTAGCTAGG + Intergenic
904016860 1:27428410-27428432 AGGTTCACAGAGCAGTATCTTGG - Intronic
907490726 1:54807264-54807286 AGGTAGTCAGTGCACAAGCTGGG - Intronic
908218985 1:61984390-61984412 AGGTGGGCAGATCACTAGCCAGG - Intronic
909491571 1:76232491-76232513 AGATGGCCAGAGCACAGGCTTGG - Intronic
911103998 1:94116014-94116036 AGGATGACAATGCACTAGCTTGG - Intronic
913210067 1:116575087-116575109 AGGTTGCCAGAGCGCTGGCTGGG - Exonic
913266924 1:117054425-117054447 AGGTTGCCTTGGGACTAGCTGGG + Intergenic
917772600 1:178296250-178296272 AGGGAGCCAGAGCTCTAGTTTGG + Intronic
922486939 1:225980754-225980776 AGGTTGCCAGAGCACTAGCTGGG - Intergenic
924246920 1:242094222-242094244 AGGTTGCAAGAGAGCTCGCTGGG + Intronic
1071049941 10:81435122-81435144 ATGGTGCCAGAGCACTAACAGGG + Intergenic
1071137578 10:82469664-82469686 AGGTACCCAGAGGAATAGCTTGG - Intronic
1073077217 10:100831711-100831733 AAGTTGCCAGGGCACTGGCTTGG + Intergenic
1074928712 10:118101345-118101367 AGGCTGACAGAGCACAATCTTGG + Intergenic
1076684081 10:132189118-132189140 AGGTGGCCAGGGCCCTAGCCTGG - Intronic
1078851818 11:15171211-15171233 AGGATGCCAGAGCTCTTCCTTGG + Intronic
1080113818 11:28599520-28599542 AGGTTGCCATACCACAAACTAGG - Intergenic
1086045212 11:82524486-82524508 AGGGAGCCAGAGCTCTAGCGAGG + Intergenic
1086886464 11:92211613-92211635 AGGTTGCCACAGGACTGCCTGGG + Intergenic
1088083732 11:105952486-105952508 ACTTAGCCAGAGCATTAGCTAGG - Intronic
1088418310 11:109614387-109614409 AGATTGGTAGACCACTAGCTAGG + Intergenic
1088792740 11:113240617-113240639 AGCTGGCCAGGGCACTAGCGAGG - Intronic
1091544322 12:1491031-1491053 AGGTTGAAAGAGCACCAGCCAGG + Exonic
1094717759 12:33030239-33030261 AGGTTGTCAGAGAAATAGATAGG - Intergenic
1095782187 12:46072313-46072335 AGGATGCCAGAGCCCGAGATTGG + Intergenic
1104945650 12:132413882-132413904 AGGTTCCCAGAAGACAAGCTGGG + Intergenic
1106253435 13:28001408-28001430 AGGCTGTCAGAGCCCTGGCTTGG + Intergenic
1107540940 13:41388562-41388584 AGGATGCCAGAGCCCTGGCAAGG - Intergenic
1111002754 13:82206214-82206236 AGGGTGTCACAGCACTGGCTTGG - Intergenic
1111396880 13:87676511-87676533 AGGTTGCAAGAGCACGCGGTGGG - Exonic
1113729933 13:112634160-112634182 AAGTTGCCAGTGCAGGAGCTGGG + Intergenic
1117695818 14:58361710-58361732 AGGTTACCCGTACACTAGCTTGG + Intronic
1120483533 14:85082438-85082460 AGGATGCAAGAGCAGGAGCTTGG + Intergenic
1122207672 14:100156208-100156230 AGGCTGCCTGAGCACCAGCCTGG + Intronic
1122281321 14:100624134-100624156 AGGTTGCCAGAGCACCATGGTGG - Intergenic
1126475745 15:49063487-49063509 AGGTAGGCAGAGCCCTAGCCGGG + Intergenic
1127124010 15:55794673-55794695 AATTTGCCAGAGAACTAGGTAGG - Intergenic
1127412222 15:58720909-58720931 GAGTTGCCATAGCACAAGCTTGG + Intronic
1128908787 15:71493297-71493319 AGTTAGACAGAGCACTGGCTTGG - Intronic
1128965385 15:72052598-72052620 AGGGTGTCAGAGCCCTGGCTTGG - Intronic
1131056549 15:89378545-89378567 CGGTTGCTAGAGCCTTAGCTGGG + Intergenic
1132832019 16:1933087-1933109 AGGCTGCCACAGCACATGCTGGG + Intergenic
1134280850 16:12815668-12815690 ATCTTCCCAAAGCACTAGCTTGG + Intergenic
1134391314 16:13822889-13822911 AGGTGGGCAGATCACTAGGTCGG - Intergenic
1134692402 16:16199474-16199496 AGGCTGCCAGAGAACCAGGTTGG - Intronic
1134979444 16:18595202-18595224 AGGCTGCCAGAGAACCAGGTTGG + Intergenic
1135511467 16:23088177-23088199 TGGGTGCCAGAGGACTAGATAGG + Intronic
1135538505 16:23312514-23312536 AGGTTATCAGAGCAATAGCCAGG - Intronic
1136660239 16:31751672-31751694 AGATTGATAGACCACTAGCTAGG - Intronic
1139872442 16:70118366-70118388 AGGTTGAGAGAGGAATAGCTGGG + Intronic
1140363330 16:74362933-74362955 AGGTTGAGAGAGGAATAGCTGGG - Intergenic
1143730251 17:8878375-8878397 AGGTTGCCAGAACACTATTCAGG - Intergenic
1145062416 17:19741541-19741563 AGGTGGTCAGAGCCCTGGCTAGG + Intronic
1145381240 17:22387969-22387991 AGGTTGCCTCAGGGCTAGCTGGG + Intergenic
1145382448 17:22394108-22394130 AGGTTGCCTCAGGGCTAGCTGGG + Intergenic
1145962133 17:28892989-28893011 AGGCTGCCACAGCTCAAGCTGGG + Intronic
1147886749 17:43689480-43689502 AGAGTGCCAGAGCACTAGCAGGG - Intergenic
1148740891 17:49891580-49891602 AGGTTGACAGAGCACGAGGTTGG + Intergenic
1149576144 17:57715160-57715182 AAGCTGCCAGAGCCCCAGCTTGG + Intergenic
1151474774 17:74339250-74339272 GGGTAGCCGGAGCACCAGCTGGG + Intronic
1155352247 18:24917987-24918009 AGGATCCCAGAGCAATGGCTGGG + Intergenic
1160604395 18:80038380-80038402 AGCATGCCAGAGCCCTGGCTTGG + Intronic
1160916171 19:1497661-1497683 GGCTTGCCAGAGGACTTGCTGGG - Exonic
926596264 2:14792327-14792349 AAGTGTCCTGAGCACTAGCTAGG - Intergenic
929236585 2:39611534-39611556 AGGTTGCCTGAGGACTACATGGG - Intergenic
929544057 2:42844252-42844274 AGGGTGCCAGGGCACTTGTTGGG + Intergenic
933276377 2:80288700-80288722 AGCTTGGCAGGGCACCAGCTTGG + Intronic
937163948 2:119794626-119794648 AGGGTGTCAGAGCCCTGGCTTGG + Intronic
937298259 2:120822903-120822925 AGGTTGCCTGAGGAAGAGCTAGG - Intronic
939529713 2:143342631-143342653 AGGTTGTCAGAGCAACAGGTGGG - Intronic
940422702 2:153498680-153498702 AGGTTGTCACAGCCCTGGCTCGG + Intergenic
941587303 2:167376746-167376768 AGATTGATAGACCACTAGCTAGG - Intergenic
944075793 2:195729563-195729585 AGTTTGCAGGAGCACCAGCTAGG - Intronic
945658623 2:212656850-212656872 AGATTGGTAGACCACTAGCTAGG - Intergenic
1168906548 20:1408465-1408487 AGGTTGTCAGGGCACCAGCATGG + Intergenic
1173126445 20:40340420-40340442 AGATTGCCACAGGACTAGCTGGG - Intergenic
1173552036 20:43939055-43939077 AGGATGCCAAAGCCCCAGCTTGG + Intronic
1175879189 20:62246935-62246957 AGGTTGCCAGAGCACCAGGAAGG - Intronic
1178416120 21:32406585-32406607 ATGATGGCAGAGCACTAGGTTGG + Intergenic
950419635 3:12891098-12891120 GGGTTGCCAGAGAACTAGGGTGG + Intergenic
954887965 3:53893253-53893275 ATGTTGCCAGAGCATAATCTGGG - Intergenic
954887972 3:53893303-53893325 ATGTTGCCAGAGCATAATCTGGG - Intergenic
958498311 3:94874235-94874257 AGGGTGTCACACCACTAGCTTGG + Intergenic
961099980 3:124190452-124190474 AGACTGCCAGAACACTAGCCAGG + Intronic
967310792 3:188104222-188104244 TGATTGCCAGAGCAGTGGCTTGG - Intergenic
970995038 4:22257413-22257435 AGATTGATAGACCACTAGCTAGG - Intergenic
974378889 4:61112055-61112077 AGGTGGCCAGAACACTAGGCAGG + Intergenic
974745613 4:66071434-66071456 AGGTGGGCAGAGCACGAGGTCGG - Intergenic
974778779 4:66524053-66524075 AGGTTGCCATTAAACTAGCTGGG - Intergenic
987984332 5:25126409-25126431 AGGATGTCAGAGCACAAGCATGG - Intergenic
988399283 5:30741110-30741132 AGGTTGCAAGAACACTGGATTGG + Intergenic
988940475 5:36140058-36140080 AGGGTGTCACAGCCCTAGCTTGG - Intronic
998152141 5:139763595-139763617 GGGTTGCCAGAGCAATAGTCAGG + Intergenic
999207838 5:149862872-149862894 TGGTTGCCGGGGCACTTGCTGGG + Intronic
1007632848 6:43282508-43282530 AGGTTTCCTGAGCACTCACTAGG + Intronic
1015991503 6:138949375-138949397 AAGTTGCCAGAGAACAAGTTGGG - Intronic
1018371447 6:163172004-163172026 AGGTAGACAGGGCCCTAGCTGGG - Intronic
1022998274 7:35781222-35781244 AGGTTGTCATAAGACTAGCTCGG + Intergenic
1026630177 7:72031218-72031240 TGGTCGCCATAGCACTCGCTTGG - Intronic
1027853058 7:83473449-83473471 AGGCTGACAGAGCATAAGCTGGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1031231547 7:119114076-119114098 AGGTCCCCAAAGCCCTAGCTGGG + Intergenic
1033659724 7:143395095-143395117 AGGAGGGCAGAGGACTAGCTGGG - Intronic
1035027183 7:155833776-155833798 AGGTTCCCAGGGCACTGCCTGGG - Intergenic
1040439235 8:47423756-47423778 AGGTTTCCAAGGCACTACCTTGG - Intronic
1047636468 8:126768571-126768593 AGCTTCTCAGAACACTAGCTTGG + Intergenic
1047655849 8:126976097-126976119 AGGGTTGCAGAGAACTAGCTAGG - Intergenic
1047759768 8:127945591-127945613 AGGTTGTCAGGGCACAGGCTGGG - Intergenic
1047853955 8:128889704-128889726 AGGTTGGCACAGCACTGGATGGG + Intergenic
1049336700 8:142090337-142090359 AGGGTGCCAGAGCCCTCGGTAGG + Intergenic
1049502620 8:142975437-142975459 AGGCTGGGAGAGCACTGGCTGGG + Intergenic
1050677326 9:8071115-8071137 AGGTAGCCAGTGCTCTAGTTGGG - Intergenic
1061101782 9:128497740-128497762 AGGTGGCCAGTGCACTTGCAAGG + Intronic
1061421724 9:130476425-130476447 GGCTTGCCAGAGCACCTGCTGGG + Intronic
1187190777 X:17032758-17032780 GGGTTGCAACAGCACTGGCTGGG - Intronic
1191589518 X:62866761-62866783 AAATTGACAGAGCACTAGCTAGG - Intergenic
1193674522 X:84433451-84433473 AGGTGCCAAGAGCACTCGCTGGG - Intronic
1198867669 X:141141933-141141955 AGGTTGCCAGAGTACCAGCATGG + Intergenic
1199199365 X:145068975-145068997 ACATTTCCAGAGCACAAGCTAGG + Intergenic