ID: 922488878

View in Genome Browser
Species Human (GRCh38)
Location 1:225999448-225999470
Sequence GGTCAAGTGAGCCGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922488866_922488878 -3 Left 922488866 1:225999428-225999450 CCCTCCCCTCCCCTGGGGCGGGT 0: 1
1: 0
2: 5
3: 48
4: 371
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488852_922488878 28 Left 922488852 1:225999397-225999419 CCAACGCCCCGCCCCTCACGCTT 0: 1
1: 0
2: 4
3: 20
4: 229
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488868_922488878 -7 Left 922488868 1:225999432-225999454 CCCCTCCCCTGGGGCGGGTCAAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488870_922488878 -9 Left 922488870 1:225999434-225999456 CCTCCCCTGGGGCGGGTCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488856_922488878 17 Left 922488856 1:225999408-225999430 CCCCTCACGCTTCCGTTCACCCC 0: 1
1: 0
2: 0
3: 13
4: 160
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488855_922488878 20 Left 922488855 1:225999405-225999427 CCGCCCCTCACGCTTCCGTTCAC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488854_922488878 21 Left 922488854 1:225999404-225999426 CCCGCCCCTCACGCTTCCGTTCA 0: 1
1: 0
2: 1
3: 12
4: 137
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488867_922488878 -4 Left 922488867 1:225999429-225999451 CCTCCCCTCCCCTGGGGCGGGTC 0: 1
1: 0
2: 5
3: 40
4: 374
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488853_922488878 22 Left 922488853 1:225999403-225999425 CCCCGCCCCTCACGCTTCCGTTC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488858_922488878 15 Left 922488858 1:225999410-225999432 CCTCACGCTTCCGTTCACCCCTC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488859_922488878 5 Left 922488859 1:225999420-225999442 CCGTTCACCCCTCCCCTCCCCTG 0: 1
1: 2
2: 51
3: 534
4: 2606
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488864_922488878 -2 Left 922488864 1:225999427-225999449 CCCCTCCCCTCCCCTGGGGCGGG 0: 1
1: 1
2: 6
3: 92
4: 717
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488869_922488878 -8 Left 922488869 1:225999433-225999455 CCCTCCCCTGGGGCGGGTCAAGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75
922488857_922488878 16 Left 922488857 1:225999409-225999431 CCCTCACGCTTCCGTTCACCCCT 0: 1
1: 0
2: 2
3: 9
4: 113
Right 922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922488878 Original CRISPR GGTCAAGTGAGCCGGGCGGC GGG Intergenic