ID: 922490519

View in Genome Browser
Species Human (GRCh38)
Location 1:226012845-226012867
Sequence ATAGAAAAGTCCAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 513}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922490514_922490519 8 Left 922490514 1:226012814-226012836 CCTATGTGATTGTATCACAGATC No data
Right 922490519 1:226012845-226012867 ATAGAAAAGTCCAATGAGAAGGG 0: 1
1: 0
2: 2
3: 30
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922490519 Original CRISPR ATAGAAAAGTCCAATGAGAA GGG Intergenic
900343092 1:2197803-2197825 AGAGATAAGTCCACAGAGAAAGG + Intronic
902464483 1:16607642-16607664 GGAGAGAAGTCCATTGAGAAAGG - Intronic
903051023 1:20601199-20601221 ATGGAAGAGACCAATGAGAGAGG - Intronic
903156328 1:21446064-21446086 GGAGAGAAGTCCAGTGAGAAAGG + Intronic
904290461 1:29482379-29482401 ATTGAACAGTCCAATGTGATAGG + Intergenic
904655000 1:32038391-32038413 GTAGAATAGTCAAAAGAGAAAGG - Intronic
905999677 1:42413551-42413573 ACAGCAAAGTCAAATGAAAAAGG + Intronic
906716858 1:47976610-47976632 GTAGAAAAGGGCAAGGAGAAAGG + Intronic
906934082 1:50196385-50196407 TTAGAAAAGTCCCAGGAGAAGGG - Intronic
906944561 1:50284682-50284704 ATAGATATGTACATTGAGAAGGG - Intergenic
908464419 1:64377732-64377754 ATAGAAACGTCAAATTAAAATGG - Intergenic
908570076 1:65400344-65400366 CTTGAAAAATCCAAAGAGAATGG - Intronic
908598463 1:65712592-65712614 ATCTAAAAGTTCAATGATAAAGG + Intergenic
908971901 1:69845641-69845663 ATAGAACACTGAAATGAGAATGG - Intronic
909016854 1:70389210-70389232 ATATATGAGTCCAATAAGAAAGG + Intergenic
909347378 1:74606828-74606850 AAAGAAAAGAGCACTGAGAAAGG - Exonic
909943616 1:81638288-81638310 AGAGAAAAGGAAAATGAGAAAGG + Intronic
911145100 1:94543983-94544005 ATCCTAAAATCCAATGAGAAAGG - Intergenic
911404903 1:97424365-97424387 ATAGAAAAGACAACTGAGAGTGG + Intronic
911444009 1:97968400-97968422 ATAGAAAAATCCTGTGAAAAAGG - Intergenic
912595984 1:110876482-110876504 ATAGAAAAGGCCAAACAAAAAGG - Intronic
913699953 1:121364834-121364856 ATAGAAAACTCCAAGCAGGATGG - Intronic
913993233 1:143634639-143634661 GGAGAGAAGTCCATTGAGAATGG - Intergenic
914040500 1:144045276-144045298 ATAGAAAACTCCAAGCAGGATGG - Intergenic
914137587 1:144915203-144915225 ATAGAAAACTCCAAGCAGGATGG + Intronic
915451688 1:156009713-156009735 AAATATGAGTCCAATGAGAAAGG + Intronic
916880669 1:169016918-169016940 GTACAAAAGCCCAGTGAGAATGG - Intergenic
917375210 1:174344945-174344967 ATACAAAAGTCAAATCAAAATGG - Intronic
918518447 1:185387938-185387960 ATAGAATATTACTATGAGAAGGG + Intergenic
918754127 1:188314819-188314841 ATATCTTAGTCCAATGAGAATGG + Intergenic
918853920 1:189726419-189726441 ATAGAAAAATCAAATCACAATGG - Intergenic
920487368 1:206383543-206383565 ATAGAAAACTCCAAGCAGGATGG - Intronic
920824696 1:209414434-209414456 ATAGAAAAGTCAAACTAGGAAGG + Intergenic
920879446 1:209866264-209866286 AAAAAAAAGGCCACTGAGAAAGG + Intergenic
921089956 1:211832762-211832784 CAAGAAAAGTCCAATGAGGTTGG - Intergenic
921981752 1:221266187-221266209 ATCCAAAAGTCCAAGGGGAATGG - Intergenic
922490519 1:226012845-226012867 ATAGAAAAGTCCAATGAGAAGGG + Intergenic
922624986 1:227030782-227030804 ACTGAAAAGTTCAATGAGTATGG - Intronic
923493681 1:234506643-234506665 ATCCAAAAGTCCAATGGGAGTGG + Intergenic
923829808 1:237542509-237542531 ACAGCAAAGTCAGATGAGAATGG - Intronic
924421811 1:243917055-243917077 ATTGAAAAGTGCGAAGAGAATGG + Intergenic
924667926 1:246092596-246092618 ATACAAAAATCCAATCAAAATGG + Intronic
924833585 1:247625822-247625844 ATAGAAAACTCAAATCAAAATGG - Intergenic
924896936 1:248349211-248349233 ATAGACAAGACCACTGAGTAGGG - Exonic
1063053254 10:2475993-2476015 ACAGAACAGAACAATGAGAAGGG - Intergenic
1065086354 10:22182417-22182439 ATAAAAAAGACCATTCAGAAAGG - Intergenic
1065283759 10:24167149-24167171 CTAGAGAAGTCCAAGCAGAAAGG - Intronic
1065297255 10:24288910-24288932 TTAGGCAAGTCCAATGAGAAGGG + Intronic
1065801558 10:29357285-29357307 ATGGAAAAGTCCTACGAAAAGGG + Intergenic
1066552068 10:36569529-36569551 AAAGAAAAGGCCAAGGAAAAGGG + Intergenic
1066782141 10:38963063-38963085 GTAGTAAAGACAAATGAGAAGGG + Intergenic
1067264198 10:44723026-44723048 ATAGAAAATCCCAAGGAAAAGGG - Intergenic
1068170365 10:53385340-53385362 ATAGAAAAAATAAATGAGAAAGG - Intergenic
1068389898 10:56381801-56381823 ACACAAAAGTCAAATGAAAATGG - Intergenic
1068459922 10:57314822-57314844 ATATAAAAGTCATATGAGCAAGG - Intergenic
1068559630 10:58499093-58499115 ATGGCAAAGTGCAGTGAGAAAGG - Intergenic
1070299288 10:75191265-75191287 ATACAGGAGACCAATGAGAAGGG - Intergenic
1072508253 10:96091758-96091780 ATAGAAAGGAAAAATGAGAAGGG + Intergenic
1073306368 10:102505842-102505864 ATATAAAGGCACAATGAGAATGG - Intronic
1074045880 10:109838578-109838600 AGAGAAAAATCCAGAGAGAATGG + Intergenic
1074383499 10:112999159-112999181 ATTGGAAAGTCCCATGAGAATGG - Intronic
1074633146 10:115281542-115281564 ATAGAAAAGTACATTTAGTAAGG + Intronic
1074754118 10:116611669-116611691 ATAGAAAAGTCCAATCAAGCTGG - Intergenic
1076069753 10:127478743-127478765 ATACAAAAATCCACTGAAAATGG - Intergenic
1076327166 10:129634013-129634035 GTAGACCAGTGCAATGAGAAAGG - Intronic
1077795698 11:5489347-5489369 ATAGGAAATGGCAATGAGAATGG - Exonic
1078564810 11:12405145-12405167 AAAAAAGAGTCCAAAGAGAAAGG + Intronic
1078776627 11:14399922-14399944 ATTTAAAAGTCCAGTTAGAAAGG + Intergenic
1079498477 11:21073869-21073891 TTAGAAATGTACAAAGAGAATGG + Intronic
1079610005 11:22420875-22420897 ATAGTTAAGTCTAATGAGATGGG + Intergenic
1079691721 11:23426869-23426891 ATACAAAATTTCAATGAGATAGG - Intergenic
1081015893 11:37879946-37879968 AGTGAAAAGTCCAATGAAAGAGG + Intergenic
1082132403 11:48506423-48506445 ATAGAAAAGTCTAATTAAAATGG + Intergenic
1082716009 11:56614713-56614735 ATAGAAAAGTCTAGTGAAATTGG + Intergenic
1084760434 11:71267443-71267465 ATATAAAAGTCAAAAGAAAATGG + Intergenic
1085360574 11:75881596-75881618 ATAGCAAAACCCAATGTGAAAGG - Intronic
1085726001 11:78955236-78955258 ACAGAAAAGTCCTGTGAGATTGG - Intronic
1085922554 11:80975903-80975925 ATTGAAAACTCCACTGAGACTGG + Intergenic
1085977643 11:81679029-81679051 ATAGAAAAATCAAATCAAAATGG - Intergenic
1087178162 11:95114649-95114671 ATACAAAAGTCAAATCAAAATGG - Intronic
1087184392 11:95172322-95172344 ATAGAAAAAAACTATGAGAAAGG + Exonic
1087401961 11:97678724-97678746 ATATAAAATTCAAATTAGAATGG - Intergenic
1087402715 11:97687850-97687872 ATGGAAAAGTCTAAAGTGAAAGG - Intergenic
1087919797 11:103853608-103853630 ATAGAAGATTCCAAGGTGAAAGG + Intergenic
1088154638 11:106788542-106788564 ATAGAAAAATCAAATTAAAATGG - Intronic
1088419211 11:109623667-109623689 ATAGAAATGCTCAAGGAGAATGG - Intergenic
1089088720 11:115847776-115847798 TTAAAACAATCCAATGAGAATGG + Intergenic
1090311675 11:125746707-125746729 ATAGATAAGTGGTATGAGAAGGG + Intronic
1091984685 12:4899619-4899641 ACAGAAACGTACAAAGAGAAGGG - Intergenic
1092611342 12:10176432-10176454 TTAGAAAAGTGCAATGCGAGCGG + Intronic
1093505332 12:19858636-19858658 ACAGAATAGTCCAGTGAGACTGG + Intergenic
1095141993 12:38675177-38675199 AGAGAAAAGTAAAATGAAAATGG - Intronic
1095445789 12:42280810-42280832 ATAGAAAAGTAGGATAAGAAAGG - Intronic
1095755676 12:45763931-45763953 ATAGAAAATTGCAAATAGAAAGG + Intronic
1097303967 12:58048585-58048607 ATACAAAAGTCAAATAAAAATGG + Intergenic
1098047642 12:66418274-66418296 ATACAAAAGTCAAATCAAAATGG + Intronic
1098204709 12:68096204-68096226 AAAGAAGAGTCCAATGAAACAGG - Intergenic
1098671230 12:73233516-73233538 ATAGAAAAAGCCAAAGACAAAGG + Intergenic
1098946565 12:76596107-76596129 GCAGAAAAGGCCAATGAGAGAGG - Intergenic
1099101357 12:78445041-78445063 ATAGAAAAATCCAAAGACAAAGG - Intergenic
1099383967 12:81991277-81991299 ATAGAAAACTGAAATAAGAAAGG + Intergenic
1099417261 12:82406294-82406316 ATAGAAAATTCAAATAACAAAGG + Intronic
1099630757 12:85141627-85141649 ACAGTAAAGTTGAATGAGAATGG - Intronic
1099974221 12:89529509-89529531 ATGGAAAAGAACAATGGGAAGGG - Intergenic
1101377820 12:104186195-104186217 ATCTAAAAGTCCAGTGAGAGAGG - Intergenic
1101558512 12:105833357-105833379 ATAACAAAACCCAATGAGAAAGG + Intergenic
1101562734 12:105874191-105874213 ATACAAAAGTCAAATCAAAATGG + Intergenic
1102871026 12:116413972-116413994 ATAGAAAAGTGCAGTGACACTGG - Intergenic
1103897621 12:124283979-124284001 AAAAAAAAGTCAAATGTGAAGGG + Intronic
1105700003 13:22928499-22928521 ATAGGAGAGTCAAATGGGAATGG + Intergenic
1108138415 13:47391292-47391314 ATACAAAAATCAAATCAGAATGG + Intergenic
1108631228 13:52284821-52284843 ATATAAAAATCCAATCAAAATGG - Intergenic
1108655464 13:52527780-52527802 ATATAAAAATCCAATCAAAATGG + Intergenic
1108872037 13:54999677-54999699 ACAGGAGAGTCCTATGAGAAAGG - Intergenic
1109180353 13:59206504-59206526 ATAGAAAATTCTAAGGAGCAAGG - Intergenic
1109629138 13:65021001-65021023 ATACAAAAGTCAAATCAAAATGG - Intergenic
1109739440 13:66532803-66532825 AAAGAAAAGACCGAGGAGAATGG - Intronic
1109826721 13:67731020-67731042 ACAGAAAAGAGCATTGAGAAAGG + Intergenic
1109926170 13:69142163-69142185 ATATAAAAGTCCAATGAGTCTGG - Intergenic
1110792215 13:79599079-79599101 ATAGATGAGGCAAATGAGAAAGG + Intergenic
1111648342 13:91060320-91060342 AGAGAAAAATGCCATGAGAATGG + Intergenic
1111759109 13:92439301-92439323 ATAGAAAAGTCCTATAAAAGAGG + Intronic
1112116726 13:96363698-96363720 ATGGAAAAGTCAAAAGAGTAAGG + Intronic
1112674280 13:101680548-101680570 ATAGAAAAGTACAATGAAAAAGG + Intronic
1112988207 13:105478474-105478496 ATATAAAATTCCAAAGAGAAAGG + Intronic
1112993522 13:105543719-105543741 ATAGATAAAACCAATGAGAATGG - Intergenic
1113206158 13:107918996-107919018 TTGGAAAAGTCCACTAAGAATGG - Intergenic
1113395789 13:109946400-109946422 ATAGAAATGACCAAAGTGAAAGG + Intergenic
1114862839 14:26547092-26547114 ATAGAAAATTATAATGAGAAAGG + Intronic
1115612369 14:35061207-35061229 CTAGAAAAGTCCAAGGCTAAGGG - Intronic
1116241946 14:42354728-42354750 ATAAAAAAGGACAATGATAAAGG + Intergenic
1116480174 14:45387570-45387592 AGAGAACAGTCCATTCAGAATGG + Intergenic
1116542604 14:46116849-46116871 ATACAAAAGTCAAATCAAAATGG + Intergenic
1116547594 14:46188806-46188828 AAAGAAAAGTTAAATGAGCAAGG - Intergenic
1116547696 14:46190829-46190851 ATACAAAAATCAAATCAGAATGG + Intergenic
1116674823 14:47892524-47892546 ATACAAAAATCCAACGAAAATGG + Intergenic
1117644645 14:57838879-57838901 ATAGAGAATTCACATGAGAATGG + Intronic
1119150004 14:72350236-72350258 CCAGAAGAGTCCAGTGAGAATGG + Intronic
1120158898 14:81124859-81124881 AAACAAAAATCCAATGAAAATGG - Intronic
1120706621 14:87752478-87752500 ATAGGAAAGTCCAAAGAAGAGGG + Intergenic
1120724062 14:87917704-87917726 ATAAAGAAGTATAATGAGAAAGG - Intronic
1121327015 14:93026701-93026723 AAATAAAAGTCCAACAAGAAGGG + Intronic
1121927349 14:97940180-97940202 ATATAACAGACCAATTAGAATGG - Intronic
1122176064 14:99920131-99920153 ATATTAAAGTCGAATGATAATGG - Intronic
1123763483 15:23451139-23451161 TTAGGAAAGTCAAATTAGAAAGG + Intergenic
1123958797 15:25371397-25371419 ATATACAAGTGCATTGAGAAAGG + Exonic
1124122420 15:26899753-26899775 ATAAAAAAGTCAAAAGTGAAAGG - Intronic
1124144983 15:27116347-27116369 ATATAAAAGTCAAATCATAAAGG - Intronic
1124920632 15:34022889-34022911 ATAGAAAAGAACAATGAGGCCGG + Intronic
1125265889 15:37880429-37880451 ATAAAAAAATCAAACGAGAAAGG + Intergenic
1125276543 15:37998355-37998377 ATATAAAAATCAAATGAAAATGG - Intergenic
1125393207 15:39218152-39218174 ATACAAAAGTCAAATCAAAATGG + Intergenic
1125497695 15:40212511-40212533 ATATAAAAGTCCCATGGGACAGG - Exonic
1125580653 15:40783105-40783127 AAAGAAAAGACGAATGATAAGGG - Intronic
1125879628 15:43182748-43182770 ATAGAAAACTGCAATGAGGCTGG - Intronic
1125956129 15:43792398-43792420 AAAGAAAAGGGCAAGGAGAAGGG - Intronic
1126197231 15:45945702-45945724 ATAAAAAAGTATAATGATAAAGG + Intergenic
1126534403 15:49745571-49745593 ATACAAAAATCAAATGAAAATGG + Intergenic
1126862420 15:52898928-52898950 ATACAAAAGTCAAATCAAAATGG - Intergenic
1126927571 15:53607502-53607524 ATACAAAAGTCAAATCAAAATGG + Intronic
1130173161 15:81538246-81538268 ATACAAAAATCAAATGAAAATGG + Intergenic
1131096775 15:89660459-89660481 ACAGAAAAGAACAAGGAGAAAGG - Intergenic
1132460671 16:52924-52946 AAAGACAAGACCAATGAGTAAGG + Intronic
1132755340 16:1481803-1481825 ATCAAAAAATACAATGAGAAAGG + Intergenic
1134078135 16:11306676-11306698 ATAAAACAATCCCATGAGAACGG + Intronic
1134384188 16:13756657-13756679 AGAGACAAATCCAAAGAGAAAGG - Intergenic
1134858472 16:17540064-17540086 TTAGAAATGTCCCATGATAAGGG - Intergenic
1135666634 16:24341057-24341079 TTAGAAAAGTAGAATGAGATTGG - Intronic
1135767812 16:25193025-25193047 ATAGAAAAATGCAATCACAAAGG - Intergenic
1137961935 16:52890193-52890215 ATAGAAAAATCAAATCAAAATGG + Intergenic
1138076725 16:54050003-54050025 AGAGAAAAGTCAAGTGAAAAGGG - Intronic
1138191931 16:55020753-55020775 CTAGAAATGTCAAATTAGAATGG + Intergenic
1139174079 16:64666109-64666131 ATAGATAATTCCAGTGAGATGGG + Intergenic
1139743843 16:69058654-69058676 AGAGAAAAGTCCAATGGTTAAGG - Intronic
1139784354 16:69379777-69379799 AGATAAAAGTTTAATGAGAAGGG + Intronic
1141011075 16:80399978-80400000 ATAAAAAAATCAAATCAGAATGG + Intergenic
1141395848 16:83703953-83703975 ATAAAAAAGTGCAATGTGCAGGG - Intronic
1142576695 17:913695-913717 AGAGAAAAGTCATCTGAGAAGGG - Intronic
1144387709 17:14765116-14765138 ATAGAGAAGTAAAAAGAGAAAGG + Intergenic
1149307044 17:55358106-55358128 ACAGTCAAGTCCAATCAGAAAGG + Intergenic
1149712121 17:58752905-58752927 TTAGAAAAGTGTAATAAGAAAGG + Intergenic
1149897297 17:60438314-60438336 ACACAAAAATCCAGTGAGAATGG - Intergenic
1150022970 17:61639228-61639250 ATAGAAAAATCAAATCAAAATGG + Intergenic
1150027341 17:61690552-61690574 ATACAAAAGAAAAATGAGAAAGG + Intronic
1150729124 17:67676586-67676608 TTGGAAAAGGCCAAGGAGAAGGG - Intronic
1150867365 17:68867433-68867455 ATTTAAAAGTCCAGTGAAAATGG + Exonic
1151648879 17:75453156-75453178 AAAGAAAGGTGCAATGAGGAAGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153901347 18:9619858-9619880 ACAGAGAAGTGAAATGAGAATGG - Intergenic
1154970819 18:21407218-21407240 ATAGAATATTCCACTGAGATTGG - Intronic
1155134349 18:22973224-22973246 ATGGTAAAATCCAATGAAAAAGG - Intronic
1156001244 18:32386964-32386986 AAATAAAATTCCAAAGAGAATGG + Intronic
1156003800 18:32416708-32416730 ATACAAAATTCAAATCAGAATGG + Intronic
1156154899 18:34289667-34289689 ATACAAAAGTCAACTGAAAATGG + Intergenic
1157149116 18:45197252-45197274 ATAGAACAGGTGAATGAGAAAGG - Intergenic
1157172263 18:45418715-45418737 ATAGAAAATTTAAATGAGACTGG + Intronic
1157321473 18:46638003-46638025 GTACAAATGTCCAATGATAAGGG + Intronic
1157445283 18:47740930-47740952 ATAGAAAAATTTAAAGAGAAAGG - Intergenic
1158430731 18:57384622-57384644 AAACAACAGTACAATGAGAATGG - Intergenic
1158454814 18:57596748-57596770 ATTGAAAGGGCCAATTAGAATGG + Intergenic
1158881941 18:61788238-61788260 ATAGAAAAATCAAATCAAAATGG - Intergenic
1159447641 18:68559894-68559916 ATAGAAACCTCGAATAAGAAAGG + Intergenic
1160030444 18:75253162-75253184 ACAGAAAAGTCCATTCACAAAGG - Intronic
1160309965 18:77779854-77779876 ATAAACAAGTCCAATGAGTTTGG + Intergenic
1162556743 19:11391489-11391511 GTTGAAATGTCCAATGAGTAGGG - Intronic
1165613130 19:37174226-37174248 AAAAAAAACTCCACTGAGAAGGG + Intronic
1166009386 19:39930401-39930423 ATACAAAAATCAAATCAGAATGG + Intronic
1167913873 19:52724993-52725015 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167921379 19:52785997-52786019 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167934204 19:52893073-52893095 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167940384 19:52941910-52941932 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167946406 19:52992566-52992588 AGAGAATAGAACAATGAGAAAGG - Intergenic
1167991791 19:53366458-53366480 AGAGAAAAGAAGAATGAGAAAGG + Intronic
927760452 2:25748509-25748531 AAAAAAAAATACAATGAGAATGG + Intronic
928781595 2:34828825-34828847 ATACAAAAATCCAATCAAAATGG - Intergenic
929206486 2:39301296-39301318 ACACAAAATTCCAATGAAAAAGG + Intronic
930365030 2:50428799-50428821 GCACAAAAATCCAATGAGAAAGG + Intronic
930497228 2:52161220-52161242 ATACAAAAGTCAAATCAAAATGG - Intergenic
930579865 2:53197396-53197418 ATAGAAAAATCAAATCAAAATGG + Intergenic
930601856 2:53452990-53453012 AAAGAAAAATCAAATTAGAAAGG + Intergenic
931559246 2:63539937-63539959 ATTTAACATTCCAATGAGAATGG - Intronic
931690649 2:64832099-64832121 AAAGAGAAGTCCAGTGTGAAAGG - Intergenic
932145845 2:69315939-69315961 ACAGAAAAGTTGAATGTGAAAGG - Intergenic
932689398 2:73899628-73899650 ATAAAAATGTCACATGAGAAAGG + Intronic
932831418 2:74994003-74994025 AAACAAAAATCCAAAGAGAAGGG - Intergenic
933148610 2:78887921-78887943 AGAGATAAGCACAATGAGAAAGG + Intergenic
933615661 2:84479928-84479950 ATATAAAGCTCCAATGAAAAAGG - Intergenic
933985429 2:87587845-87587867 TTAGAAAAGTCCAGTGAAGAAGG + Intergenic
935446610 2:103163583-103163605 CTACAAAAGCCCAATGAGATGGG + Intergenic
936308412 2:111362964-111362986 TTAGAAAAGTCCAGTGAAGAAGG - Intergenic
936848430 2:116866960-116866982 AGAGAAATGTCCAATGAATATGG + Intergenic
937111689 2:119371525-119371547 ATGGAAATGTCCCATGAAAATGG - Intronic
937194432 2:120139161-120139183 ATACAAAAATCAAATGAAAATGG + Intronic
937710226 2:124972288-124972310 TTAGAGAAGTGCATTGAGAATGG + Intergenic
938747659 2:134295213-134295235 CCAGAAAAGAACAATGAGAATGG + Intronic
939428373 2:142070981-142071003 ACAGAAAAGTAAATTGAGAAAGG + Intronic
939849421 2:147286635-147286657 AAAGAAAATCCCAGTGAGAATGG + Intergenic
940346759 2:152636770-152636792 TTAGAAAAGGACAATGAGGACGG - Intronic
941523459 2:166578081-166578103 ATACAAAAGTCAAATCAAAATGG - Intergenic
941576469 2:167238666-167238688 ATAGAATAGTCAAGTGAGCATGG - Intronic
943083266 2:183282150-183282172 ATAGGATAGTCAACTGAGAAGGG + Intergenic
943486569 2:188492523-188492545 TTAGAAAAGCCCAGTGAGATTGG + Intronic
943611201 2:190037092-190037114 AAAGAAAGTTCCAATGAGAGCGG + Intronic
944093127 2:195935852-195935874 AGAGAACAGTACACTGAGAAAGG + Intronic
944460725 2:199947180-199947202 TTGGAAAACTCTAATGAGAAAGG + Intronic
944649792 2:201818432-201818454 ACACAAAAGTCAACTGAGAAGGG - Intronic
945378401 2:209108433-209108455 ATAGAAAAGTCAAATCAAAATGG + Intergenic
945688551 2:213004362-213004384 TTAAAAAGGTCCAATTAGAATGG + Intronic
945960998 2:216134845-216134867 ATAGTTAAGTCCCATAAGAAAGG - Intronic
945973055 2:216249211-216249233 ATACAAAAATCCAATCAAAATGG + Intergenic
946760332 2:222987535-222987557 TTGTAAAAGTCCAGTGAGAAGGG + Intergenic
946970036 2:225081385-225081407 ATAAAAAAATGGAATGAGAATGG + Intergenic
947099070 2:226599970-226599992 AAAAAAAAGTCTAATGAGATAGG + Intergenic
948344429 2:237283157-237283179 AAAAAAAAGTGAAATGAGAATGG - Intergenic
1169380616 20:5103774-5103796 ATACAAAAATCAAATGAGAATGG + Intronic
1170019664 20:11822507-11822529 ATAGCATAGTCCAATAATAAAGG - Intergenic
1170361638 20:15552886-15552908 ATAGGAAAGGCAACTGAGAAGGG - Intronic
1172492519 20:35351516-35351538 TTAGAAAAGTCTTATGAAAAAGG - Intronic
1173627196 20:44481745-44481767 ATAGTAAAGTCTGAAGAGAATGG - Intronic
1175194458 20:57233341-57233363 AAAGATAAGTCCAAAGAAAATGG + Intronic
1176717156 21:10362443-10362465 ATACAAAAGTCGAATCAAAACGG - Intergenic
1176975008 21:15310595-15310617 ATAGCAATATCCAATGAGAAAGG + Intergenic
1177060000 21:16360652-16360674 TTAGAAAAATCAAATGAAAATGG - Intergenic
1177629263 21:23705375-23705397 ATAGACATGTTCAATCAGAATGG - Intergenic
1177740238 21:25145654-25145676 ATACAAAAGTCAAATGAAGATGG - Intergenic
1177873625 21:26603849-26603871 ATACAAAAATCAAATCAGAATGG - Intergenic
1178257002 21:31062744-31062766 ATATACAAGTGCATTGAGAAAGG + Intergenic
1180601180 22:17017532-17017554 ATACAAAAGTCAAATCAAAATGG + Intergenic
1181865781 22:25853782-25853804 ATGGAAAATTACAAGGAGAATGG + Intronic
1182898529 22:33878502-33878524 ATTGAAAATTCCTTTGAGAAAGG - Intronic
1183234072 22:36603356-36603378 ACAGAAAAGTGCAAGGTGAAGGG + Intronic
1183287490 22:36976655-36976677 CTAGAAGAAACCAATGAGAACGG - Intergenic
1184317469 22:43707334-43707356 GAAGAAAAGACCAGTGAGAATGG + Intronic
1185025996 22:48413088-48413110 TGAGAGAAGTCCAATCAGAAAGG + Intergenic
949273547 3:2250128-2250150 ATAGAAAAGTTAAATTATAAAGG - Intronic
950343665 3:12272202-12272224 ACAGAGAAGTCCAAGAAGAAAGG - Intergenic
950929266 3:16772813-16772835 ATAGCAAAGTGCAATAAAAAAGG + Intergenic
951296229 3:20938778-20938800 ACAGAACAGTTCAATGAAAAAGG - Intergenic
951824762 3:26856319-26856341 ATAGAAGGGGCCAGTGAGAAGGG - Intergenic
952084877 3:29807769-29807791 ATAAAAAAGTACTATGTGAAGGG + Intronic
952641268 3:35599651-35599673 ATCACAAAGTCCAATGGGAAGGG + Intergenic
954480927 3:50800309-50800331 AAAGAAAAGTCCAAAAATAATGG - Intronic
954775770 3:53016892-53016914 ATAGAAATTTCCAATGTGAAAGG - Intronic
954869906 3:53759972-53759994 GTATAAAAGTCTAATGGGAAGGG - Intronic
956223256 3:66926627-66926649 ATACAAAAGTCAAATCATAACGG + Intergenic
956308321 3:67850931-67850953 TTACAATAGTCCAATGAGATAGG + Intergenic
957239579 3:77640613-77640635 ACACAACAGTCCAATGAGATAGG - Intronic
958265717 3:91434825-91434847 ATTAAAAAGTCAAGTGAGAAAGG + Intergenic
958602585 3:96316425-96316447 ATACAAAAGTCAAATCAAAATGG - Intergenic
959191513 3:103118287-103118309 ATAGAAAAATCAAATCAAAATGG + Intergenic
959279589 3:104321930-104321952 ATACAAAAATCCAATCAAAATGG + Intergenic
959598233 3:108151007-108151029 ATGGGAAATTCCAATGAGAATGG + Intergenic
959633052 3:108530795-108530817 GAAGAAAAGTCCAATCAAAATGG + Intergenic
959876807 3:111392592-111392614 ATACAAAAGTCAAATCAAAACGG + Intronic
960144146 3:114181379-114181401 ATAGTGAAGTCCAGAGAGAAAGG - Intronic
960328588 3:116328008-116328030 AAAGAAAAATGCAAAGAGAAGGG - Intronic
960462301 3:117951473-117951495 ATTGAAAAGTTTAATGAAAATGG + Intergenic
960638808 3:119808896-119808918 ACATCAAAGTCCACTGAGAATGG - Intronic
960681847 3:120256516-120256538 ATACAAAAATCAAATGAAAATGG + Intronic
960823263 3:121757005-121757027 AAAGAAAAGTGTAATGACAAAGG - Intergenic
960943985 3:122953425-122953447 ACATAAAAATCTAATGAGAATGG - Intronic
962095684 3:132290080-132290102 ATACAAAATTCCAACAAGAAAGG - Intergenic
962168206 3:133073230-133073252 ATACAAAATTTCAATGAGACAGG - Intronic
962232412 3:133677033-133677055 ATAAAAAAGACCAAAGGGAAGGG + Intergenic
962660125 3:137593655-137593677 ATGGAAAAGTCCATGTAGAATGG + Intergenic
963410309 3:144919285-144919307 ATAGAAAAAGACAATGACAAAGG + Intergenic
963840602 3:150101786-150101808 AAATAAAAGGCAAATGAGAAAGG - Intergenic
965039843 3:163492381-163492403 ATAGAAAAATCAAATCAGCATGG - Intergenic
965130909 3:164699763-164699785 ATAGAAAAGTTATATGTGAAAGG + Intergenic
966364192 3:179165030-179165052 ACAGTAAAGTGAAATGAGAAAGG - Intronic
966366443 3:179192980-179193002 GTATAAAAGTCAAATGACAATGG + Intronic
966531052 3:180980686-180980708 ATAGAACAGTCCAATGATATGGG - Exonic
967100047 3:186209053-186209075 AGAGAAAAGTCCAGTGGGACAGG - Intronic
967132660 3:186486836-186486858 TTAGATAAGTGCAATGAGAATGG - Intergenic
967232041 3:187348565-187348587 ATATAAAAGTCAACTGAAAATGG - Intergenic
967234740 3:187373239-187373261 ATAGAGAAGGGCAAGGAGAATGG + Intergenic
970267759 4:14307829-14307851 AAAGAAGTGTCCAATAAGAAAGG - Intergenic
970482609 4:16492711-16492733 AAAGATAAGTCCATTGAAAAGGG + Intergenic
970998705 4:22297894-22297916 TTAGAAAAATCCAATTTGAAAGG - Intergenic
971048112 4:22828958-22828980 AGAGAGAAGTGCAAAGAGAAGGG - Intergenic
971613275 4:28754121-28754143 ACAGAAAATTTGAATGAGAAAGG - Intergenic
971646456 4:29212206-29212228 ATAGGAAAGAAAAATGAGAAGGG - Intergenic
971653443 4:29309713-29309735 ATGGAAAAGTCACATGATAATGG + Intergenic
971985573 4:33818506-33818528 ATAAATAAGTCCTATGACAATGG + Intergenic
973852460 4:54974739-54974761 ATGGAAAATTCCAACCAGAAGGG - Intergenic
974311197 4:60211436-60211458 ATACAAAAATCCAATCAAAATGG + Intergenic
975501730 4:75093761-75093783 ATACAAAAGTCAAATCAAAATGG - Intergenic
975559597 4:75696590-75696612 AAAGAAATGTACAAAGAGAAGGG - Intronic
976105545 4:81613312-81613334 AGAGCCAAGACCAATGAGAAGGG - Intronic
976432956 4:84984674-84984696 ATAGAAAGGCCCAGTAAGAAAGG - Intergenic
977347269 4:95832423-95832445 TTAAAAAAGTGTAATGAGAAAGG + Intergenic
977628825 4:99218799-99218821 ATAGTAAAGTAGAAAGAGAATGG - Intronic
977641769 4:99365381-99365403 ATACAAAAGTCAAATCAAAATGG - Intergenic
978483221 4:109218780-109218802 ATAAAAAACTCCCATGAGAATGG - Intronic
979265449 4:118696818-118696840 TTAGAAAATTCAGATGAGAAGGG + Intronic
979422446 4:120521951-120521973 ATACAAAAGTAAAATGAAAATGG + Intergenic
980719841 4:136680930-136680952 ATATAAATATACAATGAGAATGG + Intergenic
981314066 4:143324470-143324492 ATAGACAATTCAAAGGAGAAAGG - Intergenic
981445544 4:144833608-144833630 ATACAAAAGTACAATGATAGAGG + Intergenic
981651682 4:147066673-147066695 ATAGAAATGTCTAAAGATAATGG - Intergenic
982267602 4:153553192-153553214 ATATAAAACTCAAATGACAACGG - Intronic
982346129 4:154362187-154362209 ATAGAAAAATCCAGAGACAAAGG + Intronic
982502743 4:156178247-156178269 ATAGAAAAATAGAATAAGAATGG - Intergenic
983463930 4:168062716-168062738 ATACAAAAATCAAATGAAAATGG + Intergenic
983580036 4:169300309-169300331 ATACAAAAATCAAATCAGAATGG + Intergenic
984656054 4:182320116-182320138 AAAAAAAAATCCAAAGAGAATGG + Intronic
985344576 4:188989420-188989442 ATTAATAAGTCCAATAAGAAAGG - Intergenic
986901633 5:12441594-12441616 ATTGAAATCTCAAATGAGAAGGG - Intergenic
987149742 5:15026826-15026848 ATAGAAAAGTCAATTGAAAGAGG - Intergenic
987631871 5:20483764-20483786 ATAGATCAGTTCAATCAGAATGG + Intronic
987900757 5:24008631-24008653 ATAGAAAAATCAAATCAAAATGG - Intronic
988833381 5:35008401-35008423 AGAGGAAAGCCCAATGAGAGAGG - Intronic
989777735 5:45229508-45229530 ATAGAAAAGTCAAAGGAGATAGG - Intergenic
989802146 5:45556043-45556065 ATACAAAAGTCAAATCAAAATGG + Intronic
989991016 5:50765995-50766017 AAAGCAACGTCTAATGAGAAAGG + Intronic
990213102 5:53501850-53501872 ATAGAAAAGTCTATAGAGACAGG + Intergenic
990478948 5:56188474-56188496 ATACAAAAGTCAAATCAAAATGG - Intronic
990628735 5:57643392-57643414 AGAGGAAAGACCCATGAGAAAGG + Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
992659766 5:78947114-78947136 ATAGAAAAATCAAATCAAAATGG + Intronic
992877928 5:81076209-81076231 ATAGAAAATTCTTTTGAGAAGGG + Intronic
993191262 5:84685028-84685050 ATAAAAATATCCAATGAAAAGGG + Intergenic
994010577 5:94897510-94897532 AAAGAAAAATCCACTGAGCATGG - Intronic
994274357 5:97817586-97817608 ATAGAAAAATCAAATCAAAATGG - Intergenic
994488021 5:100403579-100403601 ATAGAAAAGAACATTGGGAAAGG + Intergenic
994513271 5:100735632-100735654 ATAGAAGAGTATAATGAAAAAGG - Intergenic
994622148 5:102176542-102176564 AGAGAAAAGGACAAGGAGAAGGG - Intergenic
994660391 5:102647046-102647068 ATACAAAAGTCAAATCAAAATGG + Intergenic
994751456 5:103742491-103742513 ATAGAAAAATAGAATGAGAGTGG + Intergenic
994752153 5:103751614-103751636 ATAGAAAAGTTCAAGCAGACCGG + Intergenic
995151758 5:108855613-108855635 ATACAAAAGACCAATGTAAAAGG + Intronic
995887033 5:116906895-116906917 ATAGAAATGTACAAGGAGATTGG + Intergenic
995907541 5:117143435-117143457 ATAGATTATACCAATGAGAAAGG - Intergenic
996024978 5:118635311-118635333 ATACAAAAATCAAATGAAAATGG + Intergenic
996085900 5:119304888-119304910 ACAGAAAAGTCCCAAAAGAATGG + Intronic
996192236 5:120559301-120559323 ATACAAAAATCCAATCAAAATGG - Intronic
996331969 5:122339891-122339913 AGAGAAAAGATGAATGAGAATGG + Intronic
996366547 5:122707463-122707485 ATAGAAAATTCCAAGAACAATGG - Intergenic
996620068 5:125489548-125489570 ATAGAACTGTCCAATAAAAAGGG - Intergenic
996656572 5:125944689-125944711 TTATCAAAGTCCAAGGAGAAAGG + Intergenic
996688544 5:126311544-126311566 ATACAAAAGTCAAATCAAAATGG + Intergenic
996877545 5:128255916-128255938 AAAGACAAGTCCATTGGGAAAGG - Intergenic
997043518 5:130286021-130286043 AGAGAGAACTCCAGTGAGAATGG + Intergenic
998877596 5:146616220-146616242 ATACAAAAGTCAAATCAAAATGG + Intronic
1000251350 5:159498583-159498605 AAAGAAAAGTTCAACAAGAAGGG - Intergenic
1000376638 5:160588813-160588835 CTAGAAAAATCTAATCAGAAAGG + Intronic
1000920514 5:167131786-167131808 ATAAAAAACACCAAAGAGAAGGG - Intergenic
1001628270 5:173155320-173155342 GTACAAAAGTCAAATGTGAAGGG - Intronic
1001988839 5:176099132-176099154 ATAGGAAGCTCCAATGAGAGTGG - Intronic
1002228028 5:177739004-177739026 ATAGGAAGCTCCAATGAGAGTGG + Intronic
1004574010 6:16875113-16875135 AAAGGAAAGTCCAATGATTATGG - Intergenic
1006071647 6:31501588-31501610 ATATAAAAATCCAATCAAAAAGG - Intronic
1006900221 6:37495334-37495356 AAAGAAAAGTGCAATGACAAAGG + Intronic
1007868393 6:45002445-45002467 ATAAAAATGGCCACTGAGAAAGG - Intronic
1007949096 6:45853889-45853911 ATAGAAAAGTACAAGCAGAAGGG + Intergenic
1008615348 6:53220798-53220820 ATAGAAGAGGCTAATGAAAAAGG + Intergenic
1009904650 6:69855520-69855542 ATAGAAAAGTTAATTGAGATCGG - Intergenic
1010299016 6:74237092-74237114 AAATAAAAGTAAAATGAGAAAGG - Intergenic
1010697598 6:78995987-78996009 ATAGTTAAGCCCAATGATAAAGG + Intronic
1011404613 6:87005575-87005597 ATACAAAAGTCAAATGAAAGTGG + Intronic
1011436243 6:87340504-87340526 TTATAAAAGTGCCATGAGAATGG + Exonic
1011710786 6:90051688-90051710 AAAAAAAAGACGAATGAGAAAGG - Intronic
1011767116 6:90634143-90634165 ATACAAAAATCAAATGAGATGGG + Intergenic
1011887882 6:92120199-92120221 ATAGTAAAGTCTAAAGATAATGG + Intergenic
1011897872 6:92254377-92254399 ATAAACAAGTACAATGAAAATGG - Intergenic
1012138956 6:95596711-95596733 ATAGAAAAGACCAAAAAGAAAGG - Intronic
1012265596 6:97138070-97138092 AGAGAAAAGTCAAATGAAAAGGG + Intronic
1012410494 6:98950380-98950402 ATAGAAAAGTCAAGTCAAAATGG - Intergenic
1012715669 6:102666274-102666296 ATACAAAAGTCAAATCAAAATGG + Intergenic
1012786084 6:103627851-103627873 ATACAATAATGCAATGAGAAAGG + Intergenic
1014115736 6:117665956-117665978 AGAGAAAAGGCAAATGAGATAGG - Intergenic
1014476833 6:121883765-121883787 ATAGAAAACTAGAATGAAAAAGG + Intergenic
1014757039 6:125312828-125312850 TAAGAACAATCCAATGAGAAAGG + Intergenic
1014836899 6:126170013-126170035 AAAGAAAAATCTAATGAGACGGG - Intergenic
1015089451 6:129337907-129337929 ACAGAAAAGTCATATGAAAAGGG + Intronic
1015167433 6:130213597-130213619 ATGGAAAAATCAAATCAGAATGG + Intronic
1015388710 6:132655643-132655665 TTAGAAAAGTCAAATCAGATCGG - Intergenic
1016251948 6:142053963-142053985 ATACAAAAGTCAAATAAAAATGG + Intergenic
1016437738 6:144055140-144055162 AAAGAAATGTCTAATGAGCACGG + Intronic
1016835945 6:148477050-148477072 ATAGAAAAATCTAATCAAAATGG + Intronic
1016916632 6:149250057-149250079 ATAGCAAAACTCAATGAGAAGGG + Intronic
1017336427 6:153266083-153266105 ATAGAAAATTCCAATAAGACAGG - Intergenic
1017398882 6:154036524-154036546 CTAGAAAAGGGCAATGGGAATGG + Intronic
1017425521 6:154316645-154316667 ATATAAAAGTTCAATGAAACAGG + Intronic
1017463931 6:154677285-154677307 AGAGAACAGTTCAAGGAGAAGGG - Intergenic
1017503017 6:155042872-155042894 AAAGAAAAGTCCAATTAGACGGG - Intronic
1017838034 6:158198083-158198105 CTAGAAGAGTACAATGATAAAGG + Exonic
1018377238 6:163224668-163224690 ATACAAAAGTCAACTCAGAATGG + Intronic
1018549057 6:164973069-164973091 ATTGCAAAGTACAATGAAAAGGG - Intergenic
1018626184 6:165781089-165781111 ATGGAATAGTCCCATGAGAGTGG + Intronic
1019029915 6:169001103-169001125 ATAGAAAAACCCAATCATAAAGG + Intergenic
1020588096 7:10097332-10097354 ATAAAAAAGTCCAATGTTGATGG + Intergenic
1020642317 7:10770642-10770664 ATACAACAATCCAATGAGATAGG + Intergenic
1020872427 7:13648606-13648628 ATGGTAAAGTCCTATTAGAAAGG + Intergenic
1020945232 7:14596907-14596929 ATCAAAAACTCAAATGAGAAAGG + Intronic
1021373946 7:19883793-19883815 ATAGAAAAGAAGAATGAGATTGG - Intergenic
1022513560 7:30960328-30960350 ACACAATTGTCCAATGAGAAAGG - Intronic
1023073223 7:36458444-36458466 ATAGGACAGTCCAAAGAGAGGGG + Intergenic
1023551948 7:41379322-41379344 AGAAAAAAGTCAAATGGGAAGGG - Intergenic
1023756823 7:43426411-43426433 TTAGAAATGACCAAGGAGAAAGG + Intronic
1023926645 7:44674502-44674524 ATTGACAAGTCTAGTGAGAATGG + Exonic
1024496495 7:50053305-50053327 TTAGAAAAGTAGACTGAGAATGG - Intronic
1027936296 7:84607821-84607843 AGGGAAAAATCCAATGAAAAAGG + Intergenic
1027973731 7:85121291-85121313 ATAGAAAAAGACAATGTGAAAGG - Intronic
1028090979 7:86700741-86700763 ATATAAAAATGCAATGTGAATGG + Intronic
1028200892 7:87959947-87959969 AGAGAAGAGTCCAAACAGAAAGG - Intronic
1029954957 7:104628736-104628758 ATAGAAAAGTTCTATGAAAATGG - Intronic
1030294841 7:107912954-107912976 ATACAAAAGTCAAATCAAAATGG - Intronic
1031078495 7:117235748-117235770 ATAGAAAAATCCAATCAAAATGG - Intergenic
1032632164 7:133665242-133665264 ATGTAAAAGTCAAATGGGAAGGG - Intronic
1034026771 7:147713205-147713227 ATAGAAATGTACACTGAAAAGGG - Intronic
1034826540 7:154270353-154270375 ATAGAAAAAACCATTTAGAATGG + Intronic
1037353755 8:17995182-17995204 ATACAAAAGTCAAATCAAAATGG - Intronic
1037555753 8:20020549-20020571 ACAGAAAAGACCATAGAGAAAGG - Intergenic
1040073644 8:43207671-43207693 ATACAAAAGTCCAGTTAGACAGG + Intergenic
1040790723 8:51225883-51225905 AAAGAAAAGTCCAATTCCAATGG + Intergenic
1040935186 8:52775014-52775036 ATTGAAAAGGGCTATGAGAAAGG - Intergenic
1041015117 8:53585273-53585295 ATAGAAAATGCCAATGTCAAGGG - Intergenic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1042317403 8:67438381-67438403 GTTGAAAAGTCAAATGTGAATGG - Intronic
1042778426 8:72462083-72462105 ATAGAAAAATCTAGTGAGCATGG - Intergenic
1042888788 8:73583591-73583613 CTAGAAAAGTCCTATGGTAAGGG + Intronic
1042980832 8:74525833-74525855 ATACAAAAGTCAAATCAGAATGG - Intergenic
1043269245 8:78308760-78308782 ATAGAAAAATCCTATGAAGATGG + Intergenic
1043283543 8:78500841-78500863 AAAGAAGAGTAGAATGAGAATGG + Intergenic
1043311610 8:78866694-78866716 ATACAAAAGTCAAATAAAAATGG - Intergenic
1043315691 8:78918766-78918788 ATATAAAAATCAAATGAAAATGG - Intergenic
1043624453 8:82238742-82238764 CTAGAAAGTTCCAATGTGAAAGG - Intergenic
1044265200 8:90173799-90173821 ACAAAAAAATTCAATGAGAAAGG + Intergenic
1044501492 8:92964091-92964113 ACAAAAAAGTACAATGGGAAAGG + Intronic
1045418908 8:101994574-101994596 ACATGAAAGTCCAATGACAAGGG + Intronic
1045706305 8:104927004-104927026 TCAGAAAAGTGCAGTGAGAATGG + Intronic
1045744913 8:105406966-105406988 ATAGAACAGTGGAATGAGGAAGG + Intronic
1046259326 8:111745923-111745945 AAAGAAAAATACAATGAGAGGGG + Intergenic
1046266375 8:111836591-111836613 AAAGCAAGGTACAATGAGAACGG - Intergenic
1046304937 8:112353804-112353826 TTACAAAAATTCAATGAGAAGGG + Intronic
1046337654 8:112811317-112811339 ATAGGAAATTCTAAAGAGAAGGG - Intronic
1047326949 8:123848689-123848711 ATTGAAAACTCAAATGAAAATGG - Intergenic
1047738647 8:127789122-127789144 AAAGAAAAAGCCAATGAGACAGG + Intergenic
1049703735 8:144027599-144027621 ATACAAAAGTTAAATCAGAATGG - Intronic
1051570268 9:18549036-18549058 ATAGGAGTGTTCAATGAGAAGGG + Intronic
1051716050 9:19985330-19985352 AAACAAAAGTCCATTGACAAGGG + Intergenic
1051923324 9:22293478-22293500 ATACAAAAATCAAATGAAAATGG - Intergenic
1052645043 9:31223972-31223994 ATACAAAAGTCACATGAAAAAGG + Intergenic
1053336976 9:37283475-37283497 ATAGAAAATTCAAGTAAGAAAGG - Intronic
1054839888 9:69726119-69726141 ATAGAAAATTCCAATAATATGGG + Intronic
1055657882 9:78470262-78470284 AAAGAAAAGTCCACTGAGAATGG - Intergenic
1055894162 9:81156852-81156874 AGAGTAAAATCCAGTGAGAAAGG - Intergenic
1058168257 9:101646227-101646249 ATACAAAAGTCAAATCAAAATGG - Intronic
1058931019 9:109718871-109718893 ATACAAAAATCAAATAAGAAAGG - Intronic
1059746412 9:117206025-117206047 ATCAAAAAGTCCAATGTGAGGGG + Intronic
1059904065 9:118962134-118962156 ATAGAGAAGTCCAGGGATAAAGG + Intergenic
1059991121 9:119867638-119867660 AGAGGAAAGTACAATGGGAAAGG + Intergenic
1060658697 9:125389912-125389934 TTAGAAATGGCCAGTGAGAATGG + Intergenic
1186677800 X:11837673-11837695 ATAGTAACTTACAATGAGAATGG + Intergenic
1186796061 X:13047617-13047639 CTTGAAAAGCCCACTGAGAAGGG - Intergenic
1187594023 X:20751026-20751048 ATACAAAAATCCAATCAAAATGG - Intergenic
1187619684 X:21038085-21038107 ATACAAAATTTCAATTAGAAAGG - Intergenic
1187633364 X:21199916-21199938 ATACAAAAATCCACTGAAAATGG + Intergenic
1188057060 X:25553709-25553731 TTAGAAGTGTCCAAAGAGAATGG - Intergenic
1188077793 X:25800174-25800196 ATACAAAAATCAAATGAAAATGG - Intergenic
1188131620 X:26441178-26441200 ACAGAAAAGCCCATTCAGAAGGG + Intergenic
1188223306 X:27566358-27566380 ATAGAAAAGCCCCGTGAGAAAGG - Intergenic
1188264708 X:28057826-28057848 ATAGAAATGGCCAATAAGTATGG - Intergenic
1188773701 X:34187048-34187070 ATACAAAAATCAAATCAGAATGG - Intergenic
1188819469 X:34756112-34756134 ACAGAAAACCTCAATGAGAATGG + Intergenic
1189565976 X:42241514-42241536 ATGAAAAAGTTCAATGAAAAAGG + Intergenic
1190449834 X:50567848-50567870 AGTGAAAAGTCCAGTGAAAAGGG + Intergenic
1190642062 X:52489652-52489674 ATACAAAAATCAAATCAGAATGG - Intergenic
1190645611 X:52523214-52523236 ATACAAAAATCAAATCAGAATGG + Intergenic
1191037002 X:56036334-56036356 ATACAAAAGTCCACTGAAAATGG - Intergenic
1191690851 X:63936307-63936329 AGAGAAAATCCCAAGGAGAAGGG - Intergenic
1191922231 X:66269393-66269415 ATACAAAAATCAAATGAAAATGG + Intergenic
1192153905 X:68728819-68728841 ATACAAAAGTCAAATCAAAATGG + Intergenic
1192893027 X:75410072-75410094 ATACAAAAGTCAAATCAAAATGG + Intronic
1193219543 X:78907144-78907166 ATACAAAAATCCAATCAAAATGG - Intergenic
1193267746 X:79493801-79493823 ATACAAAAATCAAATCAGAATGG + Intergenic
1193390641 X:80923974-80923996 ATACAAAAGTCTAATGAAACTGG - Intergenic
1193756264 X:85412406-85412428 ATATAAAAGTCAAATAAAAATGG - Intergenic
1193868740 X:86770043-86770065 AAAGAAAAGTGCAATTACAATGG + Intronic
1194046928 X:89019181-89019203 ATACAAAAATCAAATCAGAATGG + Intergenic
1194190370 X:90827958-90827980 ATAGAAAAATCAACTGAAAATGG - Intergenic
1194495218 X:94608073-94608095 ATAGAAAAATCAAATCAAAATGG - Intergenic
1194626140 X:96228446-96228468 AAACAACAGTCCAGTGAGAATGG - Intergenic
1194857586 X:98953009-98953031 ATACAAAAGTCAAATCAAAATGG - Intergenic
1195113725 X:101674437-101674459 ATAGATAAGTACAATGAAAAGGG - Intergenic
1195168348 X:102242196-102242218 ATATAAAAATCAAATCAGAATGG - Intergenic
1195190509 X:102444891-102444913 ATATAAAAATCAAATCAGAATGG + Intronic
1195350076 X:103987105-103987127 ATGGAAACGTCCAATCAGAGGGG - Intergenic
1195357368 X:104051734-104051756 ATGGAAACGTCCAATCAGAGGGG + Intergenic
1195488603 X:105439764-105439786 ACAGAAAATATCAATGAGAATGG + Intronic
1195495539 X:105528209-105528231 ATAAAAAAGTACACTGACAAGGG - Intronic
1195844858 X:109215643-109215665 ATACAAAAATCCAATCAAAATGG + Intergenic
1196919173 X:120568144-120568166 ATAGGAAAGTCCTAGGAGACTGG + Intronic
1197035392 X:121868255-121868277 ATAAAAACGGACAATGAGAAGGG - Intergenic
1197360708 X:125499489-125499511 ATAGAAAAATCAAATCAAAATGG - Intergenic
1197381835 X:125753616-125753638 ACATAAAAGTCTAATGAAAATGG - Intergenic
1197754863 X:129986234-129986256 TTAGAAAAGGCCAATAAGGAAGG + Intronic
1198710828 X:139501302-139501324 ACAGAAAAGTCCAAAGTAAAAGG + Intergenic
1198882561 X:141296730-141296752 ATACAAAAGTCAAATCAAAATGG + Intergenic
1198982358 X:142413900-142413922 ATACAAAAATCAAATGAAAAAGG + Intergenic
1199187720 X:144936946-144936968 AGAGAGAAGTCCACTGAAAAGGG + Intergenic
1199272645 X:145902709-145902731 ATAAAAAAGACTAATAAGAATGG + Intergenic
1199620725 X:149697905-149697927 AAAGAAAAGTGCAGTGCGAAGGG - Intronic
1201518233 Y:14841416-14841438 CTGGAAAATGCCAATGAGAAGGG - Exonic
1201719629 Y:17082379-17082401 CAAGAAAAGTCCAATGAACAAGG - Intergenic