ID: 922501560

View in Genome Browser
Species Human (GRCh38)
Location 1:226100647-226100669
Sequence CTTCCTAAATGGTTTGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922501560_922501571 28 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501560_922501570 14 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501570 1:226100684-226100706 ACAGTTAAGGCTCGGTGGGTGGG No data
922501560_922501564 6 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501564 1:226100676-226100698 TAATTCCCACAGTTAAGGCTCGG No data
922501560_922501562 1 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501562 1:226100671-226100693 ATGCCTAATTCCCACAGTTAAGG No data
922501560_922501569 13 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501569 1:226100683-226100705 CACAGTTAAGGCTCGGTGGGTGG No data
922501560_922501566 10 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501566 1:226100680-226100702 TCCCACAGTTAAGGCTCGGTGGG No data
922501560_922501565 9 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501565 1:226100679-226100701 TTCCCACAGTTAAGGCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922501560 Original CRISPR CTTCCTAAATGGTTTGACCT CGG (reversed) Intergenic