ID: 922501561

View in Genome Browser
Species Human (GRCh38)
Location 1:226100658-226100680
Sequence AATTAGGCATTCTTCCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922501561_922501565 -2 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501565 1:226100679-226100701 TTCCCACAGTTAAGGCTCGGTGG No data
922501561_922501569 2 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501569 1:226100683-226100705 CACAGTTAAGGCTCGGTGGGTGG No data
922501561_922501570 3 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501570 1:226100684-226100706 ACAGTTAAGGCTCGGTGGGTGGG No data
922501561_922501571 17 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501561_922501566 -1 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501566 1:226100680-226100702 TCCCACAGTTAAGGCTCGGTGGG No data
922501561_922501562 -10 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501562 1:226100671-226100693 ATGCCTAATTCCCACAGTTAAGG No data
922501561_922501564 -5 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501564 1:226100676-226100698 TAATTCCCACAGTTAAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922501561 Original CRISPR AATTAGGCATTCTTCCTAAA TGG (reversed) Intergenic