ID: 922501563

View in Genome Browser
Species Human (GRCh38)
Location 1:226100674-226100696
Sequence GAGCCTTAACTGTGGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922501563_922501571 1 Left 922501563 1:226100674-226100696 CCTAATTCCCACAGTTAAGGCTC No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501563_922501573 25 Left 922501563 1:226100674-226100696 CCTAATTCCCACAGTTAAGGCTC No data
Right 922501573 1:226100722-226100744 TCCTCGCCGTCAGGCACCTGCGG No data
922501563_922501572 16 Left 922501563 1:226100674-226100696 CCTAATTCCCACAGTTAAGGCTC No data
Right 922501572 1:226100713-226100735 CGCACAGGATCCTCGCCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922501563 Original CRISPR GAGCCTTAACTGTGGGAATT AGG (reversed) Intergenic