ID: 922501567

View in Genome Browser
Species Human (GRCh38)
Location 1:226100681-226100703
Sequence ACCCACCGAGCCTTAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922501567_922501572 9 Left 922501567 1:226100681-226100703 CCCACAGTTAAGGCTCGGTGGGT No data
Right 922501572 1:226100713-226100735 CGCACAGGATCCTCGCCGTCAGG No data
922501567_922501573 18 Left 922501567 1:226100681-226100703 CCCACAGTTAAGGCTCGGTGGGT No data
Right 922501573 1:226100722-226100744 TCCTCGCCGTCAGGCACCTGCGG No data
922501567_922501571 -6 Left 922501567 1:226100681-226100703 CCCACAGTTAAGGCTCGGTGGGT No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501567_922501576 29 Left 922501567 1:226100681-226100703 CCCACAGTTAAGGCTCGGTGGGT No data
Right 922501576 1:226100733-226100755 AGGCACCTGCGGAACACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922501567 Original CRISPR ACCCACCGAGCCTTAACTGT GGG (reversed) Intergenic