ID: 922501568

View in Genome Browser
Species Human (GRCh38)
Location 1:226100682-226100704
Sequence CACCCACCGAGCCTTAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922501568_922501571 -7 Left 922501568 1:226100682-226100704 CCACAGTTAAGGCTCGGTGGGTG No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501568_922501576 28 Left 922501568 1:226100682-226100704 CCACAGTTAAGGCTCGGTGGGTG No data
Right 922501576 1:226100733-226100755 AGGCACCTGCGGAACACACTTGG No data
922501568_922501572 8 Left 922501568 1:226100682-226100704 CCACAGTTAAGGCTCGGTGGGTG No data
Right 922501572 1:226100713-226100735 CGCACAGGATCCTCGCCGTCAGG No data
922501568_922501573 17 Left 922501568 1:226100682-226100704 CCACAGTTAAGGCTCGGTGGGTG No data
Right 922501573 1:226100722-226100744 TCCTCGCCGTCAGGCACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922501568 Original CRISPR CACCCACCGAGCCTTAACTG TGG (reversed) Intergenic