ID: 922501569

View in Genome Browser
Species Human (GRCh38)
Location 1:226100683-226100705
Sequence CACAGTTAAGGCTCGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922501559_922501569 14 Left 922501559 1:226100646-226100668 CCCGAGGTCAAACCATTTAGGAA No data
Right 922501569 1:226100683-226100705 CACAGTTAAGGCTCGGTGGGTGG No data
922501561_922501569 2 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501569 1:226100683-226100705 CACAGTTAAGGCTCGGTGGGTGG No data
922501560_922501569 13 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501569 1:226100683-226100705 CACAGTTAAGGCTCGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922501569 Original CRISPR CACAGTTAAGGCTCGGTGGG TGG Intergenic