ID: 922501570

View in Genome Browser
Species Human (GRCh38)
Location 1:226100684-226100706
Sequence ACAGTTAAGGCTCGGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922501561_922501570 3 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501570 1:226100684-226100706 ACAGTTAAGGCTCGGTGGGTGGG No data
922501560_922501570 14 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501570 1:226100684-226100706 ACAGTTAAGGCTCGGTGGGTGGG No data
922501559_922501570 15 Left 922501559 1:226100646-226100668 CCCGAGGTCAAACCATTTAGGAA No data
Right 922501570 1:226100684-226100706 ACAGTTAAGGCTCGGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922501570 Original CRISPR ACAGTTAAGGCTCGGTGGGT GGG Intergenic