ID: 922501571

View in Genome Browser
Species Human (GRCh38)
Location 1:226100698-226100720
Sequence GTGGGTGGGCGCATGCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922501568_922501571 -7 Left 922501568 1:226100682-226100704 CCACAGTTAAGGCTCGGTGGGTG No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501567_922501571 -6 Left 922501567 1:226100681-226100703 CCCACAGTTAAGGCTCGGTGGGT No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501559_922501571 29 Left 922501559 1:226100646-226100668 CCCGAGGTCAAACCATTTAGGAA No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501561_922501571 17 Left 922501561 1:226100658-226100680 CCATTTAGGAAGAATGCCTAATT No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501563_922501571 1 Left 922501563 1:226100674-226100696 CCTAATTCCCACAGTTAAGGCTC No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data
922501560_922501571 28 Left 922501560 1:226100647-226100669 CCGAGGTCAAACCATTTAGGAAG No data
Right 922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922501571 Original CRISPR GTGGGTGGGCGCATGCGCAC AGG Intergenic