ID: 922504820

View in Genome Browser
Species Human (GRCh38)
Location 1:226120455-226120477
Sequence AACTCAGTAGGGCATCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922504820_922504829 21 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504829 1:226120499-226120521 AGGGTGGGAGTCCCCAAGCCAGG No data
922504820_922504824 -9 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504824 1:226120469-226120491 TACTGAGTTTGGCAATGCTGTGG No data
922504820_922504828 6 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504828 1:226120484-226120506 TGCTGTGGTTGAGCGAGGGTGGG No data
922504820_922504830 24 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504830 1:226120502-226120524 GTGGGAGTCCCCAAGCCAGGTGG No data
922504820_922504826 2 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504826 1:226120480-226120502 GCAATGCTGTGGTTGAGCGAGGG No data
922504820_922504831 25 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504831 1:226120503-226120525 TGGGAGTCCCCAAGCCAGGTGGG No data
922504820_922504825 1 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504825 1:226120479-226120501 GGCAATGCTGTGGTTGAGCGAGG No data
922504820_922504827 5 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504827 1:226120483-226120505 ATGCTGTGGTTGAGCGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922504820 Original CRISPR AACTCAGTAGGGCATCTCTC TGG (reversed) Intergenic
No off target data available for this crispr