ID: 922504823

View in Genome Browser
Species Human (GRCh38)
Location 1:226120467-226120489
Sequence ACAGCATTGCCAAACTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922504823_922504826 -10 Left 922504823 1:226120467-226120489 CCTACTGAGTTTGGCAATGCTGT No data
Right 922504826 1:226120480-226120502 GCAATGCTGTGGTTGAGCGAGGG No data
922504823_922504829 9 Left 922504823 1:226120467-226120489 CCTACTGAGTTTGGCAATGCTGT No data
Right 922504829 1:226120499-226120521 AGGGTGGGAGTCCCCAAGCCAGG No data
922504823_922504831 13 Left 922504823 1:226120467-226120489 CCTACTGAGTTTGGCAATGCTGT No data
Right 922504831 1:226120503-226120525 TGGGAGTCCCCAAGCCAGGTGGG No data
922504823_922504827 -7 Left 922504823 1:226120467-226120489 CCTACTGAGTTTGGCAATGCTGT No data
Right 922504827 1:226120483-226120505 ATGCTGTGGTTGAGCGAGGGTGG No data
922504823_922504828 -6 Left 922504823 1:226120467-226120489 CCTACTGAGTTTGGCAATGCTGT No data
Right 922504828 1:226120484-226120506 TGCTGTGGTTGAGCGAGGGTGGG No data
922504823_922504830 12 Left 922504823 1:226120467-226120489 CCTACTGAGTTTGGCAATGCTGT No data
Right 922504830 1:226120502-226120524 GTGGGAGTCCCCAAGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922504823 Original CRISPR ACAGCATTGCCAAACTCAGT AGG (reversed) Intergenic